sb:cb1067
- Ensembl ID:
- ENSDARG00000016483
- ZFIN ID:
- ZDB-GENE-040108-10
- Human Orthologue:
- BAIAP2L2
- Human Description:
- BAI1-associated protein 2-like 2 [Source:HGNC Symbol;Acc:26203]
- Mouse Orthologue:
- Baiap2l2
- Mouse Description:
- BAI1-associated protein 2-like 2 Gene [Source:MGI Symbol;Acc:MGI:2652819]
Alleles
There are 6 alleles of this gene:
Allele name |
Consequence |
Status |
Availability Estimate |
sa26057 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa33164 |
Essential Splice Site |
Mutation detected in F1 DNA |
During 2018 |
sa26056 |
Essential Splice Site |
Mutation detected in F1 DNA |
During 2018 |
sa26055 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa38386 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa17195 |
Essential Splice Site |
Available for shipment |
Available now |
Mutation Details
- Allele Name:
- sa26057
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000024480 |
Nonsense |
4 |
419 |
1 |
14 |
- Genomic Location (Zv9):
- Chromosome 3 (position 24747671)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
3 |
24325882 |
GRCz11 |
3 |
24456430 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATGTTGTTTATTTGTTTGTTGTGCCACAGTGACAGATCAAGATGTCAGGA[C/T]AAAACAGTGATCAACTGCATCGCACCACTCTGGGCATTTATACGGTAAGC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa33164
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- T > A
- Consequence:
- Essential Splice Site
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000024480 |
Essential Splice Site |
93 |
419 |
4 |
14 |
- Genomic Location (Zv9):
- Chromosome 3 (position 24742504)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
3 |
24320715 |
GRCz11 |
3 |
24451263 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACAGATGTCAGACAGTCAGAGGAGACTCACCAACGAGCTGGAGGGAGTGG[T/A]CTGTTATTCATCCTTGACTATCGATCCATCGTTTGATATCTTCTGTTAGC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa26056
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- T > A
- Consequence:
- Essential Splice Site
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000024480 |
Essential Splice Site |
117 |
419 |
5 |
14 |
- Genomic Location (Zv9):
- Chromosome 3 (position 24742305)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
3 |
24320516 |
GRCz11 |
3 |
24451064 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CCTTCAAGAGATGGACAACAATGTCAGATTGGATAAAGATTACATATCGG[T/A]GAGTTTTATAGAGGCAACATCAGCCCTCCTGTGAATAAATATTTGTCAAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa26055
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000024480 |
Nonsense |
137 |
419 |
6 |
14 |
- Genomic Location (Zv9):
- Chromosome 3 (position 24740010)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
3 |
24318221 |
GRCz11 |
3 |
24448769 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GGAGGAGATATGAGATGGAGGTGAGAAACCAGGCAACAGCACTGGAGAGA[C/T]AGATGAGGCGAGGAGTACCGCAGGTCAGAGCACGTTTATCAATGTACATG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa38386
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000024480 |
Nonsense |
168 |
419 |
7 |
14 |
- Genomic Location (Zv9):
- Chromosome 3 (position 24739392)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
3 |
24317603 |
GRCz11 |
3 |
24448151 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTTCTCAAGGAGTGTCAGAAGGAGGCGTTAAAGGAGGAGGAAAGGCGATA[T/A]CGATTCCTGGCGGAAAAACACTGTGGGCTGACTCAGTCTATTGCTCATCT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa17195
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- T > A
- Consequence:
- Essential Splice Site
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000024480 |
Essential Splice Site |
222 |
419 |
8 |
14 |
- Genomic Location (Zv9):
- Chromosome 3 (position 24738651)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
3 |
24316862 |
GRCz11 |
3 |
24447410 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- CACAAGAGAATCMCGTTCACGCACTCCTTCAMGGCTGGAGGACAACATTG[T/A]GMGAAATAGTAMCATTTAACCCNAAAAACCCTTTTGCCCTAAATAATGATA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes
(for example, a new allele is generated or an allele is made available
for distribution) then please enter your details below: