slc17a7

Ensembl ID:
ENSDARG00000016480
ZFIN ID:
ZDB-GENE-050105-5
Description:
solute carrier family 17, member 7 [Source:RefSeq peptide;Acc:NP_001092225]
Human Orthologue:
SLC17A7
Human Description:
solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 7 [Source:HGNC
Mouse Orthologue:
Slc17a7
Mouse Description:
solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 7 Gene [Source

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16454 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16454
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104481 Nonsense 205 582 5 13
Genomic Location (Zv9):
Chromosome 3 (position 16263337)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 16493556
GRCz11 3 16643356
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCGTGTCATGGGATCTGGGCCAAATGGGCTCCACCRCTTGAAAGAAGC[C/T]GACTGGCAACAACAGCATTCTGTGGTGAGACAGACATCGGTCGATCATTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link