
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
irf9
- Ensembl ID:
- ENSDARG00000016457
- ZFIN ID:
- ZDB-GENE-040912-165
- Description:
- interferon regulatory factor 9 [Source:RefSeq peptide;Acc:NP_991273]
- Human Orthologue:
- IRF9
- Human Description:
- interferon regulatory factor 9 [Source:HGNC Symbol;Acc:6131]
- Mouse Orthologue:
- Irf9
- Mouse Description:
- interferon regulatory factor 9 Gene [Source:MGI Symbol;Acc:MGI:107587]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa17117 | Nonsense | Available for shipment | Available now |
sa6239 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa4457 | Nonsense | F2 line generated | During 2018 |
Mutation Details
- Allele Name:
- sa17117
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000005801 | Nonsense | 112 | 394 | 4 | 10 |
ENSDART00000125220 | Nonsense | 112 | 280 | 3 | 10 |
ENSDART00000137757 | Nonsense | 112 | 428 | 4 | 10 |
- Genomic Location (Zv9):
- Chromosome 12 (position 14394092)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 13249745 GRCz11 12 13288048 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GAGGTCACAGAAAGGTCACAGCTGGATATTTCAGAACCCTACAAGGTGTA[T/A]CGCCTTGTACCACCAGAAGAACAAGGTAGTCAACATGTGCTACACATTCT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa6239
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000005801 | Nonsense | 346 | 394 | 8 | 10 |
ENSDART00000125220 | None | 280 | 8 | 10 | |
ENSDART00000137757 | Nonsense | 346 | 428 | 8 | 10 |
- Genomic Location (Zv9):
- Chromosome 12 (position 14401896)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 13257549 GRCz11 12 13295852 - KASP Assay ID:
- 554-4691.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TGGAAAGATCAGGCACGCCAACCCAGCTGTTTAACCGGGAGATATTTCAA[C/T]AAGGTAAGTGTTTCACAAGCATCTACAGTATTTAGMTTTATAAAACCCAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa4457
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000005801 | Nonsense | 382 | 394 | 9 | 10 |
ENSDART00000125220 | None | 280 | 9 | 10 | |
ENSDART00000137757 | 381 | 428 | 9 | 10 |
- Genomic Location (Zv9):
- Chromosome 12 (position 14409442)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 13265095 GRCz11 12 13303398 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TGTTTTGGAGAGGAGCTCTTGGAGGRAGATAACATCTCTGATAAACACAT[C/A]ATCATTAAGGTAAATGCGTAATTGATGTACATATATAGATCATTACTACR
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: