Alleles
There are 7 alleles of this gene:
Allele name |
Consequence |
Status |
Availability Estimate |
sa41779 |
Essential Splice Site |
Mutation detected in F1 DNA |
During 2018 |
sa14938 |
Nonsense |
Available for shipment |
Available now |
sa21846 |
Nonsense |
Available for shipment |
Available now |
sa44735 |
Essential Splice Site |
Mutation detected in F1 DNA |
During 2018 |
sa35022 |
Essential Splice Site |
Mutation detected in F1 DNA |
During 2018 |
sa9585 |
Nonsense |
Available for shipment |
Available now |
sa31815 |
Essential Splice Site |
Available for shipment |
Available now |
Mutation Details
- Allele Name:
- sa41779
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000014979 |
Essential Splice Site |
18 |
1251 |
2 |
28 |
ENSDART00000103418 |
Essential Splice Site |
25 |
538 |
2 |
15 |
- Genomic Location (Zv9):
- Chromosome 11 (position 7524547)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
11 |
7368650 |
GRCz11 |
11 |
7378489 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGTAATGTTTTTTCTTTTTCTCCCATTAGCCAGCGAGATGGCAAATTATG[G/A]TATGTAAATGCAATATATATCAATCTCATTACTTATTACTTACCTGTGCT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa14938
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- T > A
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 11 (position 7520109)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
11 |
7364212 |
GRCz11 |
11 |
7374051 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- CTCCAACAGATTTTAGATTTAATCAAGCGCCTCGCACAGGCTAATWTATA[T/A]CATGTGGACAGTGARACCAGCACAGAAATTCTGGACCTAATTCAGTTGAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa21846
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 11 (position 7516366)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
11 |
7360469 |
GRCz11 |
11 |
7370308 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCTCCTACTCTCTGCTCAAAGGCTTTGCCAAGTCCCGTACCCCTGATAAT[C/T]AACATCTGTAAGCATGGTGCAAACTACAATGTGCTCTTCTCCTCTCTGTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa44735
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
- Genomic Location (Zv9):
- Chromosome 11 (position 7515788)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
11 |
7359891 |
GRCz11 |
11 |
7369730 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AACTCACGAAAGATTTAGGAATCAGCGATTTGGCTTCCATATTGAAAATT[G/A]TGAGCATCTCTGTTTCAGATTTTATTTATGTTTCTTGTCAATCATTATTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa35022
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- A > T
- Consequence:
- Essential Splice Site
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000014979 |
Essential Splice Site |
1039 |
1251 |
23 |
28 |
ENSDART00000103418 |
|
None |
538 |
None |
15 |
- Genomic Location (Zv9):
- Chromosome 11 (position 7508979)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
11 |
7353082 |
GRCz11 |
11 |
7362921 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATTGTAAAGTGTTACCCATTTTGTTATGTTTTATGTCTCCTTCTTTGTAT[A/T]GGAGACAAGAGATGAGAACACCTCCTGTGAGGAACGCAAAACATCCAGTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa9585
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- T > A
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 11 (position 7507899)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
11 |
7352002 |
GRCz11 |
11 |
7361841 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- TCTAGTTGATTTTTGTCTTTTCAGGCTCATCTCAGATGGGGTGCAGAGTG[T/A]CAAACATATGAKGTTTCTATGAGAGTGTCCGCAGCGTGCCAACCAGAGTC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa31815
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000014979 |
Essential Splice Site |
None |
1251 |
27 |
28 |
ENSDART00000103418 |
Essential Splice Site |
None |
538 |
14 |
15 |
- Genomic Location (Zv9):
- Chromosome 11 (position 7506032)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
11 |
7350135 |
GRCz11 |
11 |
7359974 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGAACTTTTGGGGATCGAAGCTGCAAATCTCACCATGTCAACTTAACAGG[T/C]TAATTTATGAACTATGGGTTACAAAACTGGTTGTTCCTGTGTACCGACAT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes
(for example, a new allele is generated or an allele is made available
for distribution) then please enter your details below: