zgc:101028

Ensembl ID:
ENSDARG00000016396
ZFIN ID:
ZDB-GENE-040801-110
Description:
Uncharacterized protein C9orf25 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q6DC60]
Human Orthologue:
C9orf25
Human Description:
chromosome 9 open reading frame 25 [Source:HGNC Symbol;Acc:19920]
Mouse Orthologue:
2310028H24Rik
Mouse Description:
RIKEN cDNA 2310028H24 gene Gene [Source:MGI Symbol;Acc:MGI:1919151]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16139 Essential Splice Site Available for shipment Available now
sa32337 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa16139
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024616 Essential Splice Site 20 186 None 6
ENSDART00000135623 Essential Splice Site 20 64 None 4
ENSDART00000144866 Essential Splice Site 20 185 None 6

The following transcripts of ENSDARG00000016396 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 11324569)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 13025934
GRCz11 21 13122922
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATTGACAGATTTCAAGTGCCACCAGTGAATCCAGAGAWGAAGCTGCTGG[T/C]AAGTGTCACTTTCACTACATGRWTAGAGAATAACACTATGTACTTTTACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32337
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024616 Essential Splice Site 116 186 None 6
ENSDART00000135623 Essential Splice Site None 64 None 4
ENSDART00000144866 Essential Splice Site 115 185 None 6

The following transcripts of ENSDARG00000016396 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 11300773)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 13002138
GRCz11 21 13099126
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGACCAGAGTCCAGATGAGAAGCCGCTTGTAGCACTGGACACAGACAGG[T/C]AAAACACTCATCAGACATTAAACCTTCACTCATTCTGTCATTCTTTCTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link