
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ENSDARG00000016381
- Ensembl ID:
- ENSDARG00000016381
- Human Orthologue:
- WNK4
- Human Description:
- WNK lysine deficient protein kinase 4 [Source:HGNC Symbol;Acc:14544]
- Mouse Orthologue:
- Wnk4
- Mouse Description:
- WNK lysine deficient protein kinase 4 Gene [Source:MGI Symbol;Acc:MGI:1917097]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa16795 | Nonsense | Available for shipment | Available now |
sa547 | Nonsense | F2 line generated | During 2018 |
sa11247 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa16795
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > G
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000088587 | Nonsense | 125 | 199 | 3 | 4 |
ENSDART00000088587 | Nonsense | 125 | 199 | 3 | 4 |
- Genomic Location (Zv9):
- Chromosome 12 (position 4249479)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 3545523 GRCz11 12 3656960 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CTCATATTGTGTTWAACAGGAACYCCTGAATTCATGGCTCCTGAAATGTA[T/G]GAGGAGAAATAYGAYGAGGCGGTGRACGTTTATGCATTTGGCATGTGWAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa547
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000088587 | Nonsense | 125 | 199 | 3 | 4 |
ENSDART00000088587 | Nonsense | 125 | 199 | 3 | 4 |
- Genomic Location (Zv9):
- Chromosome 12 (position 4249479)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 3545523 GRCz11 12 3656960 - KASP Assay ID:
- 554-0457.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CTCATATTGTGTTTAACAGGAACTCCTGAATTCATGGCTCCTGAAATGTA[T/A]GAGGAGAAATAYGAYGAGGCGGTGGACGTTTATGCATTTGGCATGTGTAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa11247
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000088587 | Nonsense | 141 | 199 | 3 | 4 |
- Genomic Location (Zv9):
- Chromosome 12 (position 4249527)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 3545571 GRCz11 12 3656912 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TAWGAGGAGAAATAYGAYGAGGCGGTGRACGTTTATGCATTTGGCATGTG[T/A]ATCTTGGAGATGACCACATCCGAATACCCRTATTCAGAGTGCCAAAACGC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: