zgc:92194

Ensembl ID:
ENSDARG00000016345
ZFIN ID:
ZDB-GENE-040912-155
Description:
nuclear receptor coactivator 5 [Source:RefSeq peptide;Acc:NP_001004588]
Human Orthologue:
NCOA5
Human Description:
nuclear receptor coactivator 5 [Source:HGNC Symbol;Acc:15909]
Mouse Orthologue:
Ncoa5
Mouse Description:
nuclear receptor coactivator 5 Gene [Source:MGI Symbol;Acc:MGI:2385165]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20828 Nonsense Available for shipment Available now
sa40805 Nonsense Mutation detected in F1 DNA During 2018
sa38584 Nonsense Mutation detected in F1 DNA During 2018
sa20829 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20828
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018270   None 479 None 7
ENSDART00000124774 Nonsense 27 622 1 10
ENSDART00000135296   None 149 None 5

The following transcripts of ENSDARG00000016345 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 55309156)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 55415331
GRCz11 6 55426756
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACCACCACCCTCGTACGTCACCAACAGCAATGACCCTCGCGACCTGGAG[C/T]GACGGATTTTTGTTGGAAATTTGCCCACGGCTCACATGGCGAAGAAGGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40805
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018270   None 479 None 7
ENSDART00000124774 Nonsense 57 622 2 10
ENSDART00000135296   None 149 None 5

The following transcripts of ENSDARG00000016345 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 55309426)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 55415601
GRCz11 6 55427026
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCTATTTTTTTTTGCGTAAAACGAAAATGATTGTTCCCTTTTTCAGCTT[T/A]GTCCCTGTTTCGTGGGTATGGATTTGTGCAGTTTGAACGATTGGAGGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38584
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018270 Nonsense 253 479 5 7
ENSDART00000124774 Nonsense 396 622 8 10
ENSDART00000135296   None 149 None 5

The following transcripts of ENSDARG00000016345 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 55315490)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 55421575
GRCz11 6 55432896
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAGAGAGGGTCATCCGGTTTCTGTTTTGACTGCGATTACGCTGCTGTCT[G/T]AGGGCAGGTACGTCAAATACAGTAGCAGCAGATGGTTTGGGATGGTTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20829
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018270 Nonsense 299 479 7 7
ENSDART00000124774 Nonsense 442 622 10 10
ENSDART00000135296   None 149 None 5

The following transcripts of ENSDARG00000016345 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 55318873)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 55424958
GRCz11 6 55436279
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCCAGGACCCCACCCTTCATCTGCGACCCTCGAGCCCTCTCAGCCTACA[C/T]AGGCCATTTCGGCTCCAGCTCAGCCCACATACTCCAGCCTGAGCCTCCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link