zgc:92518

Ensembl ID:
ENSDARG00000016343
ZFIN ID:
ZDB-GENE-040718-53
Description:
hypothetical protein LOC436634 [Source:RefSeq peptide;Acc:NP_001002361]
Mouse Orthologue:
4832428D23Rik
Mouse Description:
RIKEN cDNA 4832428D23 gene Gene [Source:MGI Symbol;Acc:MGI:2685837]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16128 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16128
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102235 Nonsense 129 209 3 5
ENSDART00000123620 Nonsense 154 239 4 6
ENSDART00000125141 Nonsense 137 241 3 6
Genomic Location (Zv9):
Chromosome 1 (position 343211)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 473335
GRCz11 1 468514
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGCAGRTGACAGAGCTGATCTGGGGTCAGCAGCTGGAGGAGCGATTCCCC[C/T]GATACACCTGTCAGTATGACTACATCCTAGCGGCGGACGTGGTGTACGGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link