zgc:65894

Ensembl ID:
ENSDARG00000016301
ZFIN ID:
ZDB-GENE-030131-7741
Description:
hypothetical protein LOC335798 [Source:RefSeq peptide;Acc:NP_956269]
Human Orthologue:
TUBB4
Human Description:
tubulin, beta 4 [Source:HGNC Symbol;Acc:20774]
Mouse Orthologue:
Tubb4
Mouse Description:
tubulin, beta 4 Gene [Source:MGI Symbol;Acc:MGI:107848]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10122 Nonsense Available for shipment Available now
sa24859 Nonsense Mutation detected in F1 DNA During 2018
sa32791 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa10122
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019573 Nonsense 59 444 3 4
Genomic Location (Zv9):
Chromosome 1 (position 56767484)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 55551417
GRCz11 1 56220713
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTGTAAAGGGGATTTTYTGGTGCTCTGTTTCTTYATCAGGTGGAAAGTA[T/A]GTCCCTCGTGCCATCCTTGTGGATCTAGAGCCTGGAACCATGGAYTCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24859
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019573 Nonsense 134 444 4 4
Genomic Location (Zv9):
Chromosome 1 (position 56765250)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 55549183
GRCz11 1 56218479
KASP Assay ID:
554-7469.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGATGTGGTGCGCAAGGAAGCCGAGAGCTGCGACTGCCTGCAGGGTTTC[C/T]AGCTGACGCACTCTCTGGGTGGAGGAACGGGCTCTGGCATGGGAACGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32791
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019573 Nonsense 397 444 4 4
Genomic Location (Zv9):
Chromosome 1 (position 56764459)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 55548392
GRCz11 1 56217688
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTCAGAGCAGTTCACGGCTATGTTTCGCCGCAAGGCCTTCTTGCATTG[G/A]TATACCGGTGAGGGAATGGATGAGATGGAGTTCACCGAGGCCGAGAGCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link