
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
fxr2
- Ensembl ID:
- ENSDARG00000016260
- ZFIN ID:
- ZDB-GENE-040426-943
- Description:
- fragile X mental retardation syndrome-related protein 2 [Source:RefSeq peptide;Acc:NP_956505]
- Human Orthologue:
- FXR2
- Human Description:
- fragile X mental retardation, autosomal homolog 2 [Source:HGNC Symbol;Acc:4024]
- Mouse Orthologue:
- Fxr2
- Mouse Description:
- fragile X mental retardation, autosomal homolog 2 Gene [Source:MGI Symbol;Acc:MGI:1346074]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa11430 | Splice Site, Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa11430
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Splice Site, Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000027718 | Splice Site, Nonsense | 448 | 676 | 12 | 17 |
ENSDART00000143341 | Splice Site, Nonsense | 448 | 583 | 12 | 15 |
- Genomic Location (Zv9):
- Chromosome 7 (position 23906210)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 22467962 GRCz11 7 22739119 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TATGGAGGAAGAGGACGCGGACGCAAACCGAACAATACATACTCCGGCTA[T/A]GGTGAGACTGGAACTTACACAATGCATATCTGTCTGTGTGTGTTTARTAG
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- IgM levels: Genome-wide scan identifies variant in TNFSF13 associated with serum IgM in a healthy Chinese male population. (View Study)
- Testosterone levels: Genome-wide association study of circulating estradiol, testosterone, and sex hormone-binding globulin in postmenopausal women. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: