
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
nudt3a
- Ensembl ID:
- ENSDARG00000016256
- ZFIN ID:
- ZDB-GENE-040426-792
- Description:
- diphosphoinositol polyphosphate phosphohydrolase 2 [Source:RefSeq peptide;Acc:NP_957439]
- Human Orthologue:
- NUDT3
- Human Description:
- nudix (nucleoside diphosphate linked moiety X)-type motif 3 [Source:HGNC Symbol;Acc:8050]
- Mouse Orthologue:
- Nudt3
- Mouse Description:
- nudix (nucleotide diphosphate linked moiety X)-type motif 3 Gene [Source:MGI Symbol;Acc:MGI:1928484]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa380 | Essential Splice Site | Available for shipment | Available now |
sa25190 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa380
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- A > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000026978 | Essential Splice Site | 71 | 170 | 3 | 7 |
ENSDART00000061713 | Essential Splice Site | 71 | 170 | 3 | 6 |
ENSDART00000141682 | Essential Splice Site | 71 | 170 | 3 | 5 |
- Genomic Location (Zv9):
- Chromosome 23 (position 3729704)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 3773079 GRCz11 23 3715982 - KASP Assay ID:
- 554-0360.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TTAAAAATGTCCTGAATTGAGTGTTTCACTGTTTTTTTTTTTATTCCCAC[A/T]GGCAGGAGTCAAAGGTACATTAGGAAGATTGGTAGGTGTTTTTGAGGTGA
- Associated Phenotype:
Normal
Stage Entity Quality Tag Larval:Day 5
ZFS:0000037whole organism
ZFA:0001094quality
PATO:0000001normal
PATO:0000461
Mutation Details
- Allele Name:
- sa25190
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000026978 | None | 170 | 7 | 7 | |
ENSDART00000061713 | Essential Splice Site | None | 170 | 6 | 6 |
ENSDART00000141682 | None | 170 | 5 | 5 |
- Genomic Location (Zv9):
- Chromosome 23 (position 3726027)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 3769402 - KASP Assay ID:
- 554-7411.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GCTTTAATGCGATTAGTTGACTTTAAAGTTGGTAAACTCGTTTCTTTTAA[A/T]GGGGTGGTCCACTATGATATCATATTTTAAACTTTAGTTGATGTGTAATG
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Body mass index: Association analyses of 249,796 individuals reveal 18 new loci associated with body mass index. (View Study)
- Height: Identification of 15 loci influencing height in a Korean population. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: