zgc:56112

Ensembl ID:
ENSDARG00000016255
ZFIN ID:
ZDB-GENE-040426-906
Description:
Charged multivesicular body protein 4b [Source:UniProtKB/Swiss-Prot;Acc:Q7ZVC4]
Human Orthologue:
CHMP4B
Human Description:
chromatin modifying protein 4B [Source:HGNC Symbol;Acc:16171]
Mouse Orthologue:
Chmp4b
Mouse Description:
chromatin modifying protein 4B Gene [Source:MGI Symbol;Acc:MGI:1922858]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa25347 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa25347
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023515 Essential Splice Site 62 220 2 5
Genomic Location (Zv9):
Chromosome 6 (position 49865978)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 49915659
GRCz11 6 49914312
KASP Assay ID:
554-7523.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTCCCATTTTCTGCTTTAATTATTCACCTTGCTTTCTCTTGTTGAAAC[A/T]GCGGCACTACAGGCGTTGAAGCGCAAGAAGCGCTATGAGAAGCAGTTAGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Stearic acid (18:0) plasma levels: Genome-wide association study identifies novel loci associated with concentrations of four plasma phospholipid fatty acids in the de novo lipogenesis pathway: results from the Cohorts for Heart and Aging Research in Genomic Epidemiology (CHARGE) consortium. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link