zgc:76925

Ensembl ID:
ENSDARG00000016233
ZFIN ID:
ZDB-GENE-040426-2049
Description:
epidermal retinal dehydrogenase 2 [Source:RefSeq peptide;Acc:NP_998043]
Human Orthologue:
SDR16C5
Human Description:
short chain dehydrogenase/reductase family 16C, member 5 [Source:HGNC Symbol;Acc:30311]
Mouse Orthologues:
Sdr16c5, Sdr16c6
Mouse Descriptions:
short chain dehydrogenase/reductase family 16C, member 5 Gene [Source:MGI Symbol;Acc:MGI:2668443]
short chain dehydrogenase/reductase family 16C, member 6 Gene [Source:MGI Symbol;Acc:MGI:2685269]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13390 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa13390
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019392 Essential Splice Site 107 306 2 7
Genomic Location (Zv9):
Chromosome 2 (position 11294824)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 11719920
GRCz11 2 11503519
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAGTGTGACTGCAGTGATAGAGAAGCAGTGTATCGAGTGGCAGATCAGG[T/A]AAGCCGAGTTCAAACCGCCGCTGTGAGTTGTTTTGCTGGAATGAAGAGTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link