zgc:112408

Ensembl ID:
ENSDARG00000016207
ZFIN ID:
ZDB-GENE-050417-63
Description:
hypothetical protein LOC550260 [Source:RefSeq peptide;Acc:NP_001017597]
Human Orthologues:
STOM, STOML3
Human Descriptions:
stomatin (EPB72)-like 3 [Source:HGNC Symbol;Acc:19420]
stomatin [Source:HGNC Symbol;Acc:3383]
Mouse Orthologues:
Stom, Stoml3
Mouse Descriptions:
stomatin (Epb7.2)-like 3 Gene [Source:MGI Symbol;Acc:MGI:2388072]
stomatin Gene [Source:MGI Symbol;Acc:MGI:95403]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9379 Nonsense Mutation detected in F1 DNA During 2018
sa17227 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9379
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043390 Nonsense 78 291 3 7
ENSDART00000144394 Nonsense 91 304 3 7
Genomic Location (Zv9):
Chromosome 24 (position 24673011)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 23919889
GRCz11 24 24065063
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTTATTAAAAGRTTGTTCAAGAATATGAGAGAGCTGTTATTTTYCGTT[T/A]GGGACGACTCCTTGGAGGTGCTAAAGGACCTGGTTAGTACTTTGAATCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17227
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043390 Nonsense 150 291 5 7
ENSDART00000144394 Nonsense 163 304 5 7
Genomic Location (Zv9):
Chromosome 24 (position 24675416)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 23922294
GRCz11 24 24067468
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGAATCTTTAACCCCACTGTCTCCATTACTAAAGTGGAGAATGCAAATTA[T/A]GCTACAYAGATGMTTGCACAGACTACATTACGAAACATGCTCGGAACTAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link