zgc:158867

Ensembl ID:
ENSDARG00000016161
ZFIN ID:
ZDB-GENE-070112-162
Description:
Zgc:158867 [Source:UniProtKB/TrEMBL;Acc:A1L2G0]
Human Orthologue:
C6orf97
Human Description:
chromosome 6 open reading frame 97 [Source:HGNC Symbol;Acc:21177]
Mouse Orthologue:
Gm221
Mouse Description:
predicted gene 221 Gene [Source:MGI Symbol;Acc:MGI:2685067]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6141 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa6141
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041211   None 251 None 6
ENSDART00000124812 Nonsense 641 693 10 10
Genomic Location (Zv9):
Chromosome 17 (position 7681834)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 7684608
GRCz11 17 7841786
KASP Assay ID:
554-3692.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCGTTYACTGCACAGGCTGCATCCCGAACTATGAAGTCCTCAGACGCCTG[G/T]AGGTTTTGATTCAGTCGCGTCAGTGTCACAGCACTGCTCATTTACACACC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link