si:dkey-34f16.5

Ensembl ID:
ENSDARG00000016122
ZFIN ID:
ZDB-GENE-081110-2
Description:
hypothetical protein LOC563207 [Source:RefSeq peptide;Acc:NP_001025446]
Human Orthologue:
C2orf79
Human Description:
chromosome 2 open reading frame 79 [Source:HGNC Symbol;Acc:33782]
Mouse Orthologue:
2410017P09Rik
Mouse Description:
RIKEN cDNA 2410017P09 gene Gene [Source:MGI Symbol;Acc:MGI:1916959]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1789 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1789
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015190 Nonsense 49 126 1 2
Genomic Location (Zv9):
Chromosome 20 (position 36824427)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 36896940
GRCz11 20 36799819
KASP Assay ID:
554-1782.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTATAACGCAAGCCTGTCACGCGGCCACTGCAGCCATTCATTTGCACTA[C/A]AGYGACCCTGACACTCAGCAGTATCTGGCGGAGCTGGACAGCATGCAKAA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Type 1 diabetes: A genome-wide meta-analysis of six type 1 diabetes cohorts identifies multiple associated loci. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link