wwp1

Ensembl ID:
ENSDARG00000016086
ZFIN IDs:
ZDB-GENE-040426-2744, ZDB-GENE-040426-2744
Description:
E3 ubiquitin-protein ligase SMURF1 [Source:RefSeq peptide;Acc:NP_001001943]
Human Orthologue:
SMURF1
Human Description:
SMAD specific E3 ubiquitin protein ligase 1 [Source:HGNC Symbol;Acc:16807]
Mouse Orthologue:
Smurf1
Mouse Description:
SMAD specific E3 ubiquitin protein ligase 1 Gene [Source:MGI Symbol;Acc:MGI:1923038]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20100 Essential Splice Site Available for shipment Available now
sa20099 Nonsense Available for shipment Available now
sa20098 Essential Splice Site Available for shipment Available now
sa7547 Missense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa20100
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004923 Essential Splice Site 68 731 3 18
ENSDART00000129705 Essential Splice Site 68 731 3 19
Genomic Location (Zv9):
Chromosome 3 (position 40710794)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 40574154
GRCz11 3 40716012
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACGGTCAAAAGCACACTGGACCCCAAGTGGAATCAGCATTACGACCTG[T/A]GAGCAAATTCATCCTCTTATCAGTGGTGTTCCTCAGGGATGGAGCTGAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20099
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004923 Nonsense 132 731 5 18
ENSDART00000129705 Nonsense 132 731 5 19
Genomic Location (Zv9):
Chromosome 3 (position 40710380)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 40573740
GRCz11 3 40715598
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTAGACTTATGCAAGTTAAACCCATCTGACAGTGATGCTGTCCGTGGA[C/T]AAATCGTTGGTACGTATTCATAGAGTTTTTCAGATATAATGGCTTCGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20098
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004923 Essential Splice Site 160 731 6 18
ENSDART00000129705 Essential Splice Site 160 731 6 19
Genomic Location (Zv9):
Chromosome 3 (position 40709962)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 40573322
GRCz11 3 40715180
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGTGGAGGGCCTGTGGTGGACTGTCGAGGACTGGTAGAGAATGAAGGG[T/G]GAGTCAACACACGTCTTGAGAATGCACAATTATTCAGCACTGGAACTGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7547
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004923 Missense 561 731 14 18
ENSDART00000129705 Missense 561 731 14 19
Genomic Location (Zv9):
Chromosome 3 (position 40695956)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 40559316
GRCz11 3 40701174
KASP Assay ID:
554-4248.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAAACCAAATGGCAAGAACATCCCAGTCACAGAGGAGAACAAGAAAGAA[T/A]ACGTGAGGTGTGAAATATTTAAAGACTACTGCAGTAGGAGATTTTTATAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link