tlr3

Ensembl ID:
ENSDARG00000016065
ZFIN ID:
ZDB-GENE-040219-7
Description:
toll-like receptor 3 [Source:RefSeq peptide;Acc:NP_001013287]
Human Orthologue:
TLR3
Human Description:
toll-like receptor 3 [Source:HGNC Symbol;Acc:11849]
Mouse Orthologue:
Tlr3
Mouse Description:
toll-like receptor 3 Gene [Source:MGI Symbol;Acc:MGI:2156367]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa39587 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa39587
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013021 Nonsense 123 903 2 5
ENSDART00000128529 Nonsense 122 902 3 6
Genomic Location (Zv9):
Chromosome 1 (position 16636387)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 17201555
GRCz11 1 17894492
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGCAACACAATCAAGTGTATTTGATAAGCGAAAAAAACCTGAAAAACTG[T/A]TTTCATTTGACACAACTTGACCTGTCTGACAATAAGCTGAAGCTACAAGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Breast size: Genetic variants associated with breast size also influence breast cancer risk. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link