zgc:113060

Ensembl ID:
ENSDARG00000016056
ZFIN ID:
ZDB-GENE-050417-464
Description:
hypothetical protein LOC550603 [Source:RefSeq peptide;Acc:NP_001017904]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21370 Nonsense Available for shipment Available now
sa6104 Nonsense Mutation detected in F1 DNA During 2018
sa41285 Nonsense Mutation detected in F1 DNA During 2018
sa27262 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa21370
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003130   None 334 1 7
ENSDART00000143807 Nonsense 3 359 1 7
Genomic Location (Zv9):
Chromosome 8 (position 47116789)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 44448481
GRCz11 8 44442387
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACACATGCGCCGTTTTACTATTTTTTAATCCACATGGATTGAATGTTTT[T/A]GAGAATGTTTTGTTTTGTTTGTTTGTTGCCATTTATTGGCGTCGTTAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6104
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003130 Nonsense 152 334 3 7
ENSDART00000143807 Nonsense 177 359 3 7
Genomic Location (Zv9):
Chromosome 8 (position 47114732)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 44450538
GRCz11 8 44444444
KASP Assay ID:
554-3936.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGGACCAACTCAAGAGGCTTCATGAAAACTTCATGTACGACAATGTGTA[T/G]CATCCTATTTGCATCAAAACTTTGCGAAGGTACCTGAATATGGAAAAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41285
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003130 Nonsense 160 334 3 7
ENSDART00000143807 Nonsense 185 359 3 7
Genomic Location (Zv9):
Chromosome 8 (position 47114709)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 44450561
GRCz11 8 44444467
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAAAACTTCATGTACGACAATGTGTATCATCCTATTTGCATCAAAACTT[T/A]GCGAAGGTACCTGAATATGGAAAAGAAGAATGTGATGAGAAAAGGTAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27262
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003130 Essential Splice Site 272 334 4 7
ENSDART00000143807 Essential Splice Site 297 359 4 7
Genomic Location (Zv9):
Chromosome 8 (position 47112666)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 44452604
GRCz11 8 44446510
KASP Assay ID:
2260-1056.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCACCGCAAACTACCTCAATCTGGACAACAAAATGGACATTGTGTTTGG[T/C]AAAAAAAAAAACAGTCTAATAACCAAAATGCCAATCTGATTATGAAAGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link