zgc:100817

Ensembl ID:
ENSDARG00000016044
ZFIN ID:
ZDB-GENE-040801-59
Description:
GINS complex subunit 4 [Source:RefSeq peptide;Acc:NP_001003546]
Human Orthologue:
GINS4
Human Description:
GINS complex subunit 4 (Sld5 homolog) [Source:HGNC Symbol;Acc:28226]
Mouse Orthologue:
Gins4
Mouse Description:
GINS complex subunit 4 (Sld5 homolog) Gene [Source:MGI Symbol;Acc:MGI:1923847]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa41309 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa41309
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021604 Essential Splice Site 162 224 6 7
Genomic Location (Zv9):
Chromosome 8 (position 54705166)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 52439938
GRCz11 8 52426467
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTGTCTAAAATTTTACTGACGTGCGTGCGTGTGTGTGTATGTGTGTGTC[T/A]GCAGTGCCTGAACCATGTCTGGACTCGTTCGTCTTCCTGAGAGTGAAAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link