
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
gpcpd1
- Ensembl ID:
- ENSDARG00000016011
- ZFIN ID:
- ZDB-GENE-060503-472
- Description:
- preimplantation protein 4-like [Source:RefSeq peptide;Acc:NP_001103993]
- Human Orthologue:
- GPCPD1
- Human Description:
- glycerophosphocholine phosphodiesterase GDE1 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:26957]
- Mouse Orthologue:
- Gpcpd1
- Mouse Description:
- glycerophosphocholine phosphodiesterase GDE1 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI
Alleles
There are 4 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa12862 | Nonsense | Available for shipment | Available now |
sa13354 | Nonsense | Available for shipment | Available now |
sa23800 | Nonsense | Available for shipment | Available now |
sa23799 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa12862
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000027482 | Nonsense | 49 | 666 | 4 | 20 |
ENSDART00000124283 | Nonsense | 49 | 666 | 3 | 19 |
- Genomic Location (Zv9):
- Chromosome 20 (position 45908587)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 45802276 GRCz11 20 45705996 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ATTTAYCTCCTGTGTTTTGCTCACATGCCYTCTCTCACCTCCCAGCACCT[T/A]ATGGAGAACAACCATTCACGTTCCTAGAGGAGCTGAAACCAAAWATCGCT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa13354
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000027482 | Nonsense | 375 | 666 | 12 | 20 |
ENSDART00000124283 | Nonsense | 375 | 666 | 11 | 19 |
- Genomic Location (Zv9):
- Chromosome 20 (position 45888387)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 45782076 GRCz11 20 45685796 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CATCTGTCTAAAGATTTAGTTCCWGTCGTTTACCACGATCTCACTTGCTG[T/A]ATTTCTACTAAAAAGGTAACACATTGTTTGCTGGAGTCAATGTTAATCAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa23800
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000027482 | Nonsense | 388 | 666 | 13 | 20 |
ENSDART00000124283 | Nonsense | 388 | 666 | 12 | 19 |
- Genomic Location (Zv9):
- Chromosome 20 (position 45884874)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 45778563 GRCz11 20 45682283 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CTGTTTCTGGTCTTGTTCGCTTTCCTAGAAAAATGACAAGACTTCAATGT[T/A]GTTGTTCGAAGTTCCTGTCAAAGATCTTACATTTGATCAACTTCAGCTCT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa23799
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000027482 | Nonsense | 515 | 666 | 18 | 20 |
ENSDART00000124283 | Nonsense | 515 | 666 | 17 | 19 |
- Genomic Location (Zv9):
- Chromosome 20 (position 45880101)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 45773790 GRCz11 20 45677510 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTGCAAAAAATGTGTGTTTTCTACAGGGTGAGGCAGAAACAGAACAAATA[T/A]CCGATCCTGTTTCTGACCCAAGGAGTGACACAGCTCTATCCTGAGCTCAT
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Cortical structure: Association of common genetic variants in GPCPD1 with scaling of visual cortical surface area in humans. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: