wdhd1

Ensembl ID:
ENSDARG00000015998
ZFIN ID:
ZDB-GENE-030131-1665
Description:
WD repeat and HMG-box DNA-binding protein 1 [Source:RefSeq peptide;Acc:NP_001002726]
Human Orthologue:
WDHD1
Human Description:
WD repeat and HMG-box DNA binding protein 1 [Source:HGNC Symbol;Acc:23170]
Mouse Orthologue:
Wdhd1
Mouse Description:
WD repeat and HMG-box DNA binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:2443514]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17677 Essential Splice Site Available for shipment Available now
sa32138 Missense Available for shipment Available now
sa23024 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17677
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002176 Essential Splice Site 114 305 5 13
ENSDART00000110507 Essential Splice Site 114 1112 4 25
ENSDART00000133710 Essential Splice Site 116 1114 5 26
ENSDART00000138764 Essential Splice Site 114 305 5 13

The following transcripts of ENSDARG00000015998 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 15023295)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 15174123
GRCz11 17 15182056
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTGAAAATGTTCWTGGATGAAGGTGCTAATTTTGGGCTTGTGTTTTTCA[G/T]TGACTTCCTGGTRAAGATGGYGGAGGTGGCCGACAGCAGTCAGCAGAARA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32138
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002176   None 305 None 13
ENSDART00000110507 Missense 818 1112 18 25
ENSDART00000133710 Missense 820 1114 19 26
ENSDART00000138764   None 305 None 13

The following transcripts of ENSDARG00000015998 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 15001550)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 15152378
GRCz11 17 15160311
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCCCTGGCACAGAGACTCAGTGAACTCGCCCTGGAAAAAGCCAATCAGC[T/C]GCAAGAGGAGGAGCAGGAAGATGAGGAGCCAGCCTATCAGAGGTGAGCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23024
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002176   None 305 13 13
ENSDART00000110507 Nonsense 1071 1112 25 25
ENSDART00000133710 Nonsense 1073 1114 26 26
ENSDART00000138764   None 305 13 13

The following transcripts of ENSDARG00000015998 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 14991538)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 15142366
GRCz11 17 15150299
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATTCAGAACTGGACGGAGAAAGCAAAGGGTGACTCTGACCCCAAGAAA[C/T]GAAAACGTGAAGATGAAGATGAAGAAAAAGCAGCTGAACAAATGGAGTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link