zgc:63934

Ensembl ID:
ENSDARG00000015989
ZFIN ID:
ZDB-GENE-040426-1301
Description:
hypothetical protein LOC393316 [Source:RefSeq peptide;Acc:NP_956639]
Human Orthologue:
ZDHHC16
Human Description:
zinc finger, DHHC-type containing 16 [Source:HGNC Symbol;Acc:20714]
Mouse Orthologue:
Zdhhc16
Mouse Description:
zinc finger, DHHC domain containing 16 Gene [Source:MGI Symbol;Acc:MGI:1921418]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30954 Nonsense Mutation detected in F1 DNA During 2018
sa35182 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa30954
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005789 Nonsense 33 386 1 11
ENSDART00000114854 Nonsense 37 239 2 9
Genomic Location (Zv9):
Chromosome 12 (position 3439003)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 2826003
GRCz11 12 2860736
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTCTGTCCTCGTCGGGGACACAGAAAGCGCAGCAGAGTCCGAGACCTGT[G/A]GAATTATGGGATGGTGGTGCTGAAGTCCCTCTACTACAACGTCCAGACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35182
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005789 Essential Splice Site 140 386 2 11
ENSDART00000114854 Essential Splice Site 144 239 3 9
Genomic Location (Zv9):
Chromosome 12 (position 3438512)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 2825512
GRCz11 12 2860245
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTCATTACTATAAAGCCACGACCACACAGCCTGGATTCCCTCCGCAGG[T/C]GCTGCACTACGTTACACTTGTTTTTGCACAGTCTAGTTCACATTTGAAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link