
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
NP_957420.1
- Ensembl ID:
- ENSDARG00000015971
- Description:
- Rap guanine nucleotide exchange factor (GEF) 1 [Source:RefSeq peptide;Acc:NP_957420]
- Human Orthologue:
- RAPGEF1
- Human Description:
- Rap guanine nucleotide exchange factor (GEF) 1 [Source:HGNC Symbol;Acc:4568]
- Mouse Orthologue:
- Rapgef1
- Mouse Description:
- Rap guanine nucleotide exchange factor (GEF) 1 Gene [Source:MGI Symbol;Acc:MGI:104580]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa32327 | Nonsense | Available for shipment | Available now |
sa18460 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa32327
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000015576 | Nonsense | 102 | 684 | 2 | 16 |
ENSDART00000123759 | Nonsense | 127 | 1080 | 3 | 24 |
ENSDART00000127761 | Nonsense | 102 | 684 | 2 | 16 |
ENSDART00000144179 | Nonsense | 103 | 621 | 2 | 11 |
- Genomic Location (Zv9):
- Chromosome 21 (position 4423648)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 21 4001060 GRCz11 21 4165625 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CTGGTTCGGCTAGTAAAGTTTTAGAGGCTATTTTGCCTCTGATGCAGGTC[G/T]AGGCTCGGATACAGCACAGGTGAGTATTCACTGCTAATAAACATCGTATT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa18460
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000015576 | Nonsense | 128 | 684 | 3 | 16 |
ENSDART00000123759 | Nonsense | 153 | 1080 | 4 | 24 |
ENSDART00000127761 | Nonsense | 128 | 684 | 3 | 16 |
ENSDART00000144179 | Nonsense | 129 | 621 | 3 | 11 |
- Genomic Location (Zv9):
- Chromosome 21 (position 4423919)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 21 4001331 GRCz11 21 4165896 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TCCTCCTGTCACAACCGTGTTTATCAGAGCTTGGCGACTCTGATTCGCTG[G/A]TCCGACCAGGTGATGCTGGAGGGYATCGAYCTCGACGACAAGGACACTGT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: