si:dkey-261l7.3

Ensembl ID:
ENSDARG00000015970
ZFIN ID:
ZDB-GENE-050208-261
Human Orthologue:
PHIP
Human Description:
pleckstrin homology domain interacting protein [Source:HGNC Symbol;Acc:15673]
Mouse Orthologue:
Phip
Mouse Description:
pleckstrin homology domain interacting protein Gene [Source:MGI Symbol;Acc:MGI:1932404]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32455 Nonsense Available for shipment Available now
sa29964 Essential Splice Site Mutation detected in F1 DNA During 2018
sa31091 Nonsense Mutation detected in F1 DNA During 2018
sa39419 Nonsense Mutation detected in F1 DNA During 2018
sa32454 Nonsense Available for shipment Available now
sa13928 Nonsense Available for shipment Available now
sa24372 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32455
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008401 Nonsense 182 1635 5 34
ENSDART00000138106 Nonsense 354 1805 11 39

The following transcripts of ENSDARG00000015970 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 31559126)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 31394016
GRCz11 23 31320547
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGACGGGCAGCACTGATCACATCATTAGGGTTTATTACTTTGGAGGTGGA[C/T]AACCAGAGAAGATATCTGAGCTGGAGTCTCACACTGTACGTAATGCATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29964
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008401 Essential Splice Site 337 1635 9 34
ENSDART00000138106 Essential Splice Site 509 1805 15 39

The following transcripts of ENSDARG00000015970 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 31547975)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 31382865
GRCz11 23 31309396
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTCTGGGATCTGGCTAGAGGAGTCAAAATACGCTCTTACTTTAACATGG[T/G]AAAACAACCAGCTCCACTCCATGTCTTTTATTAGGTCGTAGTGTGTGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31091
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008401 Nonsense 469 1635 12 34
ENSDART00000138106 Nonsense 641 1805 18 39

The following transcripts of ENSDARG00000015970 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 31545344)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 31380234
GRCz11 23 31306765
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGTATTTTAGGGCTAAATCAAGTGGTAAGTCAGCAGGCTGCAGAAGGCT[C/A]GAGTCCACTTGATAGTATGATCCAGAGACTACAGCAAGAGCAGGACCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39419
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008401 Nonsense 856 1635 21 34
ENSDART00000138106 Nonsense 1028 1805 27 39

The following transcripts of ENSDARG00000015970 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 31532518)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 31367408
GRCz11 23 31293939
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGAGTGGCTTTTAACCCTTGCCTTGCATCTCTATTGGTGACTCAGATA[T/G]CACGACATGCCTGATGTCATCGACTTCCTGGTTCTTCGGCAGCAGTTTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32454
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008401 Nonsense 906 1635 22 34
ENSDART00000138106 Nonsense 1078 1805 28 39

The following transcripts of ENSDARG00000015970 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 31530580)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 31365470
GRCz11 23 31292001
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGATTGATGATGCCTGGTGGTTTGGTACGATTGAGAGTCAAGAGCCGTAC[C/T]AGGCCGAATATCCAGACTCTCTGTTCCAGTGCTACAACGTCTGGTCAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13928
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008401 Nonsense 973 1635 24 34
ENSDART00000138106 Nonsense 1145 1805 30 39

The following transcripts of ENSDARG00000015970 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 31528587)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 31363477
GRCz11 23 31290008
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGAGCAGAAGGCCTTACTGTACAAGCCGCTGGACGGAGAGTGGGGCTCA[C/T]GAACACGCAACCAGGAGTGTGAACGCWTCATCAGGGGCATCAACCAGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24372
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008401 Nonsense 1515 1635 33 34
ENSDART00000138106 Nonsense 1685 1805 39 39

The following transcripts of ENSDARG00000015970 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 31515105)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 31349995
GRCz11 23 31276526
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGATGATGGCGGGGCTTCTTCAACAGCCCAAGACAGTAATCTTTCAGATT[C/A]GGGAGAGTATCCGAAAGCACGAGGCAGACCACGAATCACAAAGACGATAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link