zgc:153311

Ensembl ID:
ENSDARG00000015964
ZFIN ID:
ZDB-GENE-060825-194
Description:
hypothetical protein LOC751666 [Source:RefSeq peptide;Acc:NP_001038848]
Human Orthologues:
CLDN22, CLDN24, CLDN25
Human Descriptions:
claudin 22 [Source:HGNC Symbol;Acc:2044]
claudin 24 [Source:HGNC Symbol;Acc:37200]
claudin 25 [Source:HGNC Symbol;Acc:37218]
Mouse Orthologues:
AC160137.1, Cldn22, Cldn24
Mouse Descriptions:
claudin 22 Gene [Source:MGI Symbol;Acc:MGI:1922927]
claudin 24 Gene [Source:MGI Symbol;Acc:MGI:3712484]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33884 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa33884
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025698 Nonsense 81 221 1 1
Genomic Location (Zv9):
Chromosome 6 (position 30175296)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 30497638
GRCz11 6 30484552
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCGTCCCTATGACACCATCCTAGGTCTTGACCCCACTGTGATGCTGGCA[C/T]GAATTCTGATGTGCATGTCGAATGCCACTGGGCTCCTCGGGATTCTCCTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link