stat6

Ensembl ID:
ENSDARG00000015902
ZFIN ID:
ZDB-GENE-030131-9359
Description:
signal transducer and activator of transcription 6, interleukin-4 induced [Source:RefSeq peptide;Ac
Human Orthologue:
STAT6
Human Description:
signal transducer and activator of transcription 6, interleukin-4 induced [Source:HGNC Symbol;Acc:11
Mouse Orthologue:
Stat6
Mouse Description:
signal transducer and activator of transcription 6 Gene [Source:MGI Symbol;Acc:MGI:103034]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24352 Essential Splice Site Available for shipment Available now
sa24351 Essential Splice Site Available for shipment Available now
sa9252 Nonsense Mutation detected in F1 DNA During 2018
sa37727 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa24352
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023218 Essential Splice Site 93 758 4 21
ENSDART00000059346 Essential Splice Site 87 674 4 26
ENSDART00000139231   None 470 None 14
ENSDART00000146467 Essential Splice Site 93 272 4 8

The following transcripts of ENSDARG00000015902 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 27351294)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 27184116
GRCz11 23 27110657
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTATTCCCTCCTCTTTTTGATGTAACCTGCTGAATTGTTTCTGTGCTATA[G/A]AGTGTGCTTTACCCACAACCCTTACAACTTGTGAGGACAGTTCGGGAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24351
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023218 Essential Splice Site 528 758 13 21
ENSDART00000059346 Essential Splice Site 519 674 17 26
ENSDART00000139231 Essential Splice Site 240 470 6 14
ENSDART00000146467   None 272 None 8

The following transcripts of ENSDARG00000015902 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 27330850)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 27163672
GRCz11 23 27090213
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCCTGGAGATTTCGAAAACATGCTTGTTTCCTGGGCTCAATTCAACAAG[G/A]TAACACTAACATGCAATTTACATATCGTATATGTTCATTAATATATTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9252
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023218 Nonsense 554 758 14 21
ENSDART00000059346 Nonsense 545 674 18 26
ENSDART00000139231 Nonsense 266 470 7 14
ENSDART00000146467   None 272 None 8

The following transcripts of ENSDARG00000015902 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 27329052)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 27161874
GRCz11 23 27088415
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTTCTGGCAGTGGTTTGAAGGGGCAATAGACCTAACTAAGAGATGCCTA[C/T]GAGAYTATTGGACAGATGGGTAAAGTTGCAATTACTTAAGTTTCTTTTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37727
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023218 Essential Splice Site 707 758 None 21
ENSDART00000059346 Essential Splice Site None 674 None 26
ENSDART00000139231 Essential Splice Site 419 470 None 14
ENSDART00000146467   None 272 None 8

The following transcripts of ENSDARG00000015902 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 27326053)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 27158875
GRCz11 23 27085416
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTATGAATTTTATTTCACCATCTACGTCTCAGGCATTTGGGCAAAACATG[T/A]GAGTATTGAAGTAATTCTATATTTGTATTTTTCTATAAAGCCAGAAATTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link