zgc:193613

Ensembl ID:
ENSDARG00000015866
ZFIN ID:
ZDB-GENE-030131-1046
Description:
hypothetical protein LOC322327 [Source:RefSeq peptide;Acc:NP_001124058]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22838 Essential Splice Site Available for shipment Available now
sa42718 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa22838
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058964 Essential Splice Site 89 141 None 4
ENSDART00000135084 Essential Splice Site 89 141 None 4

The following transcripts of ENSDARG00000015866 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 26219135)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 24064810
GRCz11 16 23979842
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGAACTGAAGAAAAGCCCAAGAGTGGAGAGCTTCATCAAAATCGCTGGG[T/C]AAGGGATACCGTACAGTGAATATTCCATTAAAAAATCATTCAAGTTTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42718
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058964 Nonsense 130 141 4 4
ENSDART00000135084 Nonsense 130 141 4 4

The following transcripts of ENSDARG00000015866 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 26219351)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 24065026
GRCz11 16 23980058
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTTCAGACCCTATGTTGGTGCGTACCTGGACAGTGCCATCAACAACGTC[A/T]AGCCCGTGCTGGACACCGTACTGCCCCAGGGAAATTAAGAGTCTTGTTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link