trim25

Ensembl ID:
ENSDARG00000015865
ZFIN ID:
ZDB-GENE-040426-797
Description:
E3 ubiquitin/ISG15 ligase TRIM25 [Source:RefSeq peptide;Acc:NP_956469]
Human Orthologue:
TRIM25
Human Description:
tripartite motif-containing 25 [Source:HGNC Symbol;Acc:12932]
Mouse Orthologue:
Trim25
Mouse Description:
tripartite motif-containing 25 Gene [Source:MGI Symbol;Acc:MGI:102749]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa38547 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa38547
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013659 Nonsense 609 654 11 11
ENSDART00000144680 Nonsense 277 287 7 7

The following transcripts of ENSDARG00000015865 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 19520864)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 21918207
GRCz11 6 18389528
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGAGAATCCAAATCCAAGCCGTGTTGGCATCTTGCTGGACTGCGATCAG[G/T]GAAGTGCAACATTCTATAATGTGCAGGATCGTGCGTACCCCTTTCACACG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Many sequence variants affecting diversity of adult human height. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link