
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
mtmr9
- Ensembl ID:
- ENSDARG00000015860
- ZFIN ID:
- ZDB-GENE-040724-223
- Description:
- myotubularin-related protein 9 [Source:RefSeq peptide;Acc:NP_001038535]
- Human Orthologue:
- MTMR9
- Human Description:
- myotubularin related protein 9 [Source:HGNC Symbol;Acc:14596]
- Mouse Orthologue:
- Mtmr9
- Mouse Description:
- myotubularin related protein 9 Gene [Source:MGI Symbol;Acc:MGI:2442842]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa9609 | Essential Splice Site | Available for shipment | Available now |
sa6627 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa16766 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa9609
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- A > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000035447 | Essential Splice Site | 98 | 549 | 3 | 10 |
- Genomic Location (Zv9):
- Chromosome 20 (position 19028840)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 19057097 GRCz11 20 18956680 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TAGTGATCARTGTAGGCTGTCAGTGTTTAYGTTATGAGGATCTCTCCTCC[A/T]GGCTCTGTCCACGCTGGACTCTGTGTCWCTGATGTACCCRTTCTTCTAYC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa6627
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000035447 | Nonsense | 288 | 549 | 6 | 10 |
- Genomic Location (Zv9):
- Chromosome 20 (position 19033936)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 19062193 GRCz11 20 18961776 - KASP Assay ID:
- 554-4882.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CTAACATCCTGCAGGAGAGCCTGATAAAGCTGGTGGAGGCCTGCAATGAT[C/T]AGTCTCACAACATGGACCGCTGGCTCAGTAAACTCGAGGCCTCCAACTGG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa16766
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000035447 | Nonsense | 427 | 549 | 8 | 10 |
- Genomic Location (Zv9):
- Chromosome 20 (position 19041032)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 19069289 GRCz11 20 18968872 - KASP Assay ID:
- 2261-4123.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AGTTYCCTTGCTCATTTCAGTTCAGCGAGAGCTTTCTCATCATGCTYTTC[G/T]AGCACACCTATGCCTCACAGTTTGGCACTTTCCTCGGCAACAGTGTGGCT
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Retinal vascular caliber: Four novel Loci (19q13, 6q24, 12q24, and 5q14) influence the microcirculation in vivo. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: