zgc:56628

Ensembl ID:
ENSDARG00000015849
ZFIN ID:
ZDB-GENE-040426-1099
Description:
hypothetical protein LOC393242 [Source:RefSeq peptide;Acc:NP_956566]
Human Orthologue:
LMO4
Human Description:
LIM domain only 4 [Source:HGNC Symbol;Acc:6644]
Mouse Orthologue:
Lmo4
Mouse Description:
LIM domain only 4 Gene [Source:MGI Symbol;Acc:MGI:109360]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6010 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa6010
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022112 Nonsense 159 172 3 3
ENSDART00000147346 Nonsense 148 161 4 4
Genomic Location (Zv9):
Chromosome 2 (position 23133264)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 22756650
GRCz11 2 22412301
KASP Assay ID:
554-3735.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAATGGAAAACTGTACTGTGAGCGGGACAAATCTGCAGCTTCTGAACACT[C/A]GGATTCACTCAGGGAGCATGACATATCCCAACAAAAATCCTGAGATGCTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link