zgc:73242

Ensembl ID:
ENSDARG00000015835
ZFIN ID:
ZDB-GENE-040426-1728
Description:
hypothetical protein LOC393732 [Source:RefSeq peptide;Acc:NP_957053]
Human Orthologue:
EIF4E2
Human Description:
eukaryotic translation initiation factor 4E family member 2 [Source:HGNC Symbol;Acc:3293]
Mouse Orthologue:
Eif4e2
Mouse Description:
eukaryotic translation initiation factor 4E member 2 Gene [Source:MGI Symbol;Acc:MGI:1914440]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32468 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa32468
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014691 Essential Splice Site 6 228 1 7
Genomic Location (Zv9):
Chromosome 23 (position 44555205)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 44622754
GRCz11 23 44428158
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTGAAAGAAGAAGCAGGAACGACAACGCGGAATGAATCAGTTTGAACAG[T/A]AAGTTAGCAGCTAACGGCTAATATTCTCCATTAAACATTTAACTTCAGCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Non-small cell lung cancer: Genome-wide association study on overall survival of advanced non-small cell lung cancer patients treated with carboplatin and paclitaxel. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link