
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
rab22a
- Ensembl ID:
- ENSDARG00000015807
- ZFIN ID:
- ZDB-GENE-041114-161
- Description:
- ras-related protein Rab-22A [Source:RefSeq peptide;Acc:NP_991282]
- Human Orthologue:
- RAB22A
- Human Description:
- RAB22A, member RAS oncogene family [Source:HGNC Symbol;Acc:9764]
- Mouse Orthologue:
- Rab22a
- Mouse Description:
- RAB22A, member RAS oncogene family Gene [Source:MGI Symbol;Acc:MGI:105072]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa5387 | Nonsense | F2 line generated | During 2018 |
sa7049 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa5387
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000022581 | Nonsense | 59 | 196 | 3 | 7 |
The following transcripts of ENSDARG00000015807 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 6 (position 49508512)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 6 49558193 GRCz11 6 49556846 - KASP Assay ID:
- 554-3544.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ATGACAAAGACTGTGCAATACCAAAAYGAGCTTCACAAATTCCTCATCTG[G/A]GACACAGCAGGACAAGAAAGGGTAAACAGTAACAATCACTACACACACAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa7049
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000022581 | Essential Splice Site | 90 | 196 | None | 7 |
The following transcripts of ENSDARG00000015807 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 6 (position 49518311)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 6 49567992 GRCz11 6 49566645 - KASP Assay ID:
- 554-4107.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CTACAGAGGCTCTGCTGCGGCCATCATCGTCTATGACATCACTAAAGAGG[T/A]ACTGAAACATTTCTTCGTTATTACCACACAAATCTTTCTTCTGGTAAAGM
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: