
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
mmp13b
- Ensembl ID:
- ENSDARG00000015797
- ZFIN ID:
- ZDB-GENE-030131-6152
- Human Orthologue:
- MMP13
- Human Description:
- matrix metallopeptidase 13 (collagenase 3) [Source:HGNC Symbol;Acc:7159]
- Mouse Orthologue:
- Mmp13
- Mouse Description:
- matrix metallopeptidase 13 Gene [Source:MGI Symbol;Acc:MGI:1340026]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa562 | Essential Splice Site | Available for shipment | Available now |
sa35941 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa562
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000033206 | Essential Splice Site | 164 | 464 | 3 | 10 |
- Genomic Location (Zv9):
- Chromosome 15 (position 32042936)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 15 33973611 GRCz11 15 33831590 - KASP Assay ID:
- 554-0472.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GAAAACGTTTGATGGAACTGCCGACATCATGATCAGCTTTGGAACAAAAG[G/A]TACCACCGTTTGTGTCATTTATGCAGGATTCACTGCAGGGTGTTTATCCT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa35941
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000033206 | Nonsense | 434 | 464 | 10 | 10 |
- Genomic Location (Zv9):
- Chromosome 15 (position 32047923)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 15 33968624 GRCz11 15 33826603 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACACCAATGCATGAATGTTAATAACTGTTTGTATTTTTTAACAGGATACT[T/A]GAACTTGTATCATGAACATACTCAGTTTGAGTACAGTTACAGCGCAAGGA
- Associated Phenotype:
- Not determined
OMIM
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: