atp1b3a

Ensembl ID:
ENSDARG00000015790
ZFIN ID:
ZDB-GENE-990415-167
Description:
ATPase, Na+/K+ transporting, beta 3a polypeptide [Source:RefSeq peptide;Acc:NP_571296]
Human Orthologue:
ATP1B3
Human Description:
ATPase, Na+/K+ transporting, beta 3 polypeptide [Source:HGNC Symbol;Acc:806]
Mouse Orthologue:
Atp1b3
Mouse Description:
ATPase, Na+/K+ transporting, beta 3 polypeptide Gene [Source:MGI Symbol;Acc:MGI:107788]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31268 Nonsense Available for shipment Available now
sa32871 Nonsense Mutation detected in F1 DNA During 2018
sa25786 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa31268
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022549 Nonsense 111 278 3 7
ENSDART00000100282 Nonsense 108 275 5 9

The following transcripts of ENSDARG00000015790 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 16383293)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 16894120
GRCz11 2 16562710
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAACAGATCAGATCCTCTTGAATATGGCCAGTATGTCCAGCATCTAGAAT[C/A]GTTTCTGCATCGTAAGTGCTCAGCATACATCCTTTGAAACATTTCTGAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32871
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022549 Nonsense 127 278 4 7
ENSDART00000100282 Nonsense 124 275 6 9

The following transcripts of ENSDARG00000015790 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 16383150)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 16893977
GRCz11 2 16562567
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTCCGTTTCCAGAATATAATGACTCGGAACAAGCCAAAAATGACTTGTG[T/A]ATGGCGGGACAGTACTCTGAGCAGGATGGGGAATCTCTGAAAAAGGTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25786
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022549 Nonsense 218 278 6 7
ENSDART00000100282 Nonsense 215 275 8 9

The following transcripts of ENSDARG00000015790 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 16374394)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 16885221
GRCz11 2 16553811
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTATTTCCCCCATGAGGGGACTATTGATAGGATGTACTTCCCTTACTA[T/A]GGGAAAAAGACACATGTAAGTATGGCAGTCAGCACATGCTTTAAAGGATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link