ankrd46

Ensembl ID:
ENSDARG00000015780
ZFIN ID:
ZDB-GENE-050114-7
Description:
Ankyrin repeat domain-containing protein 46 [Source:UniProtKB/Swiss-Prot;Acc:Q6TNT2]
Human Orthologue:
ANKRD46
Human Description:
ankyrin repeat domain 46 [Source:HGNC Symbol;Acc:27229]
Mouse Orthologue:
Ankrd46
Mouse Description:
ankyrin repeat domain 46 Gene [Source:MGI Symbol;Acc:MGI:1916089]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa27048 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa27048
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022918 Nonsense 92 228 2 4
Genomic Location (Zv9):
Chromosome 7 (position 52369399)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 50639149
GRCz11 7 50914219
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTATCAGGGCAACACGGCGCTGCACCTGTGCGGGCACGTGGACACCATT[C/T]AGTTCCTCGTCTCCAATGGCCTCAAAATAGATATTTGGTGAGATGTGCCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link