tspan7

Ensembl ID:
ENSDARG00000015759
ZFIN ID:
ZDB-GENE-030131-5435
Description:
tetraspanin-6 [Source:RefSeq peptide;Acc:NP_999939]
Human Orthologue:
TSPAN6
Human Description:
tetraspanin 6 [Source:HGNC Symbol;Acc:11858]
Mouse Orthologue:
Tspan6
Mouse Description:
tetraspanin 6 Gene [Source:MGI Symbol;Acc:MGI:1926264]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa35748 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa35748
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016002 Nonsense 216 251 6 8
Genomic Location (Zv9):
Chromosome 14 (position 43005937)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 41105190
GRCz11 14 41472444
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTATAGGGCTGTTTCTCTCTGATGTCCACAACCATGGAGGCCAATCTT[G/T]GAATTATTGCTGGAATTTCTTTTGGAATTGCATTCTTCCAGGTATTTTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link