tmem50a

Ensembl ID:
ENSDARG00000015757
ZFIN ID:
ZDB-GENE-040426-2937
Description:
transmembrane protein 50A [Source:RefSeq peptide;Acc:NP_998694]
Human Orthologue:
TMEM50A
Human Description:
transmembrane protein 50A [Source:HGNC Symbol;Acc:30590]
Mouse Orthologue:
Tmem50a
Mouse Description:
transmembrane protein 50A Gene [Source:MGI Symbol;Acc:MGI:1919067]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa35583 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa35583
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019774 Nonsense 49 164 3 7
ENSDART00000134730 Nonsense 49 164 3 7
ENSDART00000142381 Nonsense 49 150 3 6

The following transcripts of ENSDARG00000015757 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 46108622)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 45351530
GRCz11 13 45488434
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGCAGTTTTTTACAGGCTGGTGGATCATCATCGACGCAGCGATAATGTA[T/A]CCTAAAGAGGAACAGTTCCACCATGCGTATCATACCTGTGGCGTTATAGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link