zap70

Ensembl ID:
ENSDARG00000015752
ZFIN ID:
ZDB-GENE-050522-257
Description:
tyrosine-protein kinase ZAP-70 [Source:RefSeq peptide;Acc:NP_001018425]
Human Orthologue:
ZAP70
Human Description:
zeta-chain (TCR) associated protein kinase 70kDa [Source:HGNC Symbol;Acc:12858]
Mouse Orthologue:
Zap70
Mouse Description:
zeta-chain (TCR) associated protein kinase Gene [Source:MGI Symbol;Acc:MGI:99613]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21262 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa21262
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015038 Essential Splice Site 188 604 None 13
ENSDART00000134755 Essential Splice Site 188 218 None 3
Genomic Location (Zv9):
Chromosome 8 (position 20940247)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 20370144
GRCz11 8 20402229
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATTTAGGCTCATCAGTAAGGAGATTGCTAATAGTTTGTTGTTTTTTTCC[A/G]GAGTTCGAGAGAGAGATGAAATGGGCACCTTTGCACTGTCTGTGACGTAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link