zgc:152969

Ensembl ID:
ENSDARG00000015749
ZFIN ID:
ZDB-GENE-061110-115
Description:
Hermansky-Pudlak syndrome 3 protein [Source:RefSeq peptide;Acc:NP_001180471]
Human Orthologue:
HPS3
Human Description:
Hermansky-Pudlak syndrome 3 [Source:HGNC Symbol;Acc:15597]
Mouse Orthologue:
Hps3
Mouse Description:
Hermansky-Pudlak syndrome 3 homolog (human) Gene [Source:MGI Symbol;Acc:MGI:2153839]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6717 Nonsense Mutation detected in F1 DNA During 2018
sa10831 Nonsense Available for shipment Available now
sa43887 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa6717
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015103 Nonsense 165 1003 3 18
ENSDART00000059690 Nonsense 165 524 3 11
ENSDART00000140968 Nonsense 209 1042 3 18
Genomic Location (Zv9):
Chromosome 22 (position 41180586)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 38268225
GRCz11 22 38221372
KASP Assay ID:
554-5220.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
RTCTTCTRGTGGGGAGTGCCAAGAGTCTGGTGGTCTTCAGTCTGAAGCGG[C/T]AGACTCTGAGCGAGCAGYTGTCGGTGCTGGACTTCGAGAGAGTTCTGATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10831
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015103 Nonsense 361 1003 6 18
ENSDART00000059690 Nonsense 361 524 6 11
ENSDART00000140968 Nonsense 405 1042 6 18
Genomic Location (Zv9):
Chromosome 22 (position 41177528)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 38265167
GRCz11 22 38218314
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGTATGTTTGTTTTCTTCTCCTTGCCCAACACCGGCTACATGTACAGCT[T/G]AAAGTCTTCAGTGGAGCTCGTGTCCACATACCAGTACCCAGAAAAGGCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43887
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015103 Essential Splice Site 419 1003 7 18
ENSDART00000059690 Essential Splice Site 419 524 7 11
ENSDART00000140968 Essential Splice Site 463 1042 7 18
Genomic Location (Zv9):
Chromosome 22 (position 41176499)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 38264138
GRCz11 22 38217285
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCAGTAGCAGCTCGGGTTCAGGACCCCTACATCGACACCACCATGAAGG[T/C]AACGCAGCTCAGCACACACATCTCTGCTCTTGCATTACTTTGTTTTAACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link