flt4
- Ensembl ID:
- ENSDARG00000015717
- ZFIN ID:
- ZDB-GENE-980526-326
- Description:
- Vascular endothelial growth factor receptor 3 [Source:UniProtKB/Swiss-Prot;Acc:Q5MD89]
- Human Orthologue:
- FLT4
- Human Description:
- fms-related tyrosine kinase 4 [Source:HGNC Symbol;Acc:3767]
- Mouse Orthologue:
- Flt4
- Mouse Description:
- FMS-like tyrosine kinase 4 Gene [Source:MGI Symbol;Acc:MGI:95561]
Alleles
There are 10 alleles of this gene:
Allele name |
Consequence |
Status |
Availability Estimate |
sa42378 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa35677 |
Essential Splice Site |
Available for shipment |
Available now |
sa9798 |
Nonsense |
Available for shipment |
Available now |
sa281 |
Nonsense |
F2 line generated |
During 2018 |
sa35676 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa31980 |
Nonsense |
Available for shipment |
Available now |
sa44806 |
Essential Splice Site |
Mutation detected in F1 DNA |
During 2018 |
sa16036 |
Nonsense |
Available for shipment |
Available now |
sa35675 |
Essential Splice Site |
Mutation detected in F1 DNA |
During 2018 |
sa30675 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
Mutation Details
- Allele Name:
- sa42378
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- T > G
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000125081 |
Nonsense |
86 |
1368 |
3 |
30 |
- Genomic Location (Zv9):
- Chromosome 14 (position 19820163)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
14 |
15614616 |
GRCz11 |
14 |
15920179 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GAGTTTACTGATCGCCAGGGTCAGCAGTCACCCACTGACACCCCAGGGTA[T/G]AGAGAAATCAGGCTGAAGGAGTGTCAAGGGGTGGCTGGAAAACCCTACTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa35677
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000125081 |
Essential Splice Site |
186 |
1368 |
4 |
30 |
- Genomic Location (Zv9):
- Chromosome 14 (position 19804357)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
14 |
15598810 |
GRCz11 |
14 |
15904373 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGTACCATGTCTGGTTTCAGATCCTGACCTAAAAGTCACTCTCTTCTCGG[T/C]AGGTCTCCAACACGCTTCCAGCAGCAACTCACCTGATCTCTCTGTTTCTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa9798
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000125081 |
Nonsense |
563 |
1368 |
12 |
30 |
- Genomic Location (Zv9):
- Chromosome 14 (position 19773956)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
14 |
15568409 |
GRCz11 |
14 |
15873972 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- YGGCCGTGTGGTTATWCAGAATGCCAGTGTGCCAGCTATGTACAAGTGCT[T/A]GGCTGAGAACAAAGTGGGAAAAGATGAACGACTGATTTATTTCTACGTAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa281
- Current Status:
-
F2 line generated
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000125081 |
Nonsense |
593 |
1368 |
13 |
30 |
- Genomic Location (Zv9):
- Chromosome 14 (position 19772144)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
14 |
15566597 |
GRCz11 |
14 |
15872160 |
- KASP Assay ID:
- 554-2919.1 (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- TAACATTCATTTAGCTATCCCTGAAGGATTCGATATAGAGATGGAGCCCT[C/A]AGAGGATCCGCTTGAGCAGGACCTGGTRCAGCTGAAGTGTAATGCAGATA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa35676
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000125081 |
Nonsense |
741 |
1368 |
14 |
30 |
- Genomic Location (Zv9):
- Chromosome 14 (position 19770417)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
14 |
15564870 |
GRCz11 |
14 |
15870433 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GCACACCCTTTCCTCAGCTGTCCTGGTTTAAAGATAACCAACCCCTCCAT[C/T]AGATATCAGGTTAGTCATTCATCACACTTTTCAATACTAACATTTAAAAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa31980
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000125081 |
Nonsense |
1031 |
1368 |
22 |
30 |
- Genomic Location (Zv9):
- Chromosome 14 (position 19736387)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
14 |
15530840 |
GRCz11 |
14 |
15836403 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AAACTCCACTCACAATAGAGGATCTGATATGCTACAGTTTTCAAGTTGCA[C/T]GAGGAATGGAGTTTCTGGCATCTCGTAAGGTAATTTTCAAACATTTATTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa44806
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- T > A
- Consequence:
- Essential Splice Site
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000125081 |
Essential Splice Site |
1040 |
1368 |
22 |
30 |
- Genomic Location (Zv9):
- Chromosome 14 (position 19736356)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
14 |
15530809 |
GRCz11 |
14 |
15836372 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CTACAGTTTTCAAGTTGCACGAGGAATGGAGTTTCTGGCATCTCGTAAGG[T/A]AATTTTCAAACATTTATTTAATCTTAACCTCTGTGATGAATCCTTTATTC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa16036
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- G > A
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000125081 |
Nonsense |
1088 |
1368 |
24 |
30 |
- Genomic Location (Zv9):
- Chromosome 14 (position 19733259)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
14 |
15527712 |
GRCz11 |
14 |
15833275 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- TTATAGGTGAAGTGTTATCTGTCTTTGCAGGCYAGGCTGCCGCTGAAGTG[G/A]ATGGCTCCAGAGAGCATCTTTGATAARGTTTACACCAGTCAGAGTGACGT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa35675
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000125081 |
Essential Splice Site |
1119 |
1368 |
24 |
30 |
- Genomic Location (Zv9):
- Chromosome 14 (position 19733166)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
14 |
15527619 |
GRCz11 |
14 |
15833182 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGTGACGTCTGGTCTTTTGGAGTTCTGCTCTGGGAGATTTTCTCACTAGG[T/C]AACAGTTAACCGGGGCAGCTGCAATTAACGCAATGGAGCTGATCAATGGA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa30675
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000125081 |
Nonsense |
1182 |
1368 |
26 |
30 |
- Genomic Location (Zv9):
- Chromosome 14 (position 19729462)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
14 |
15523915 |
GRCz11 |
14 |
15829478 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GGGAGAGACCCACATTTCCAGCTCTGGTGGAGATACTTGGAGATCTACTG[C/T]AGGAAAACAGTCTACCAGTGAGAAGATGCACACACACACACACATTGTGA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes
(for example, a new allele is generated or an allele is made available
for distribution) then please enter your details below: