ENSDARG00000015717 - Zebrafish Mutation Project

Search Zebrafish Mutation Project

e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457

You can look for mutant lines by browsing a complete list or by searching for a particular gene

flt4

Ensembl ID:: ENSDARG00000015717
ZFIN ID:: ZDB-GENE-980526-326
Description:: Vascular endothelial growth factor receptor 3 [Source:UniProtKB/Swiss-Prot;Acc:Q5MD89]
Human Orthologue:: FLT4
Human Description:: fms-related tyrosine kinase 4 [Source:HGNC Symbol;Acc:3767]
Mouse Orthologue:: Flt4
Mouse Description:: FMS-like tyrosine kinase 4 Gene [Source:MGI Symbol;Acc:MGI:95561]

Alleles

There are 10 alleles of this gene:

Allele name	Consequence	Status	Availability Estimate
sa42378	Nonsense	Mutation detected in F1 DNA	During 2018
sa35677	Essential Splice Site	Available for shipment	Available now
sa9798	Nonsense	Available for shipment	Available now
sa281	Nonsense	F2 line generated	During 2018
sa35676	Nonsense	Mutation detected in F1 DNA	During 2018
sa31980	Nonsense	Available for shipment	Available now
sa44806	Essential Splice Site	Mutation detected in F1 DNA	During 2018
sa16036	Nonsense	Available for shipment	Available now
sa35675	Essential Splice Site	Mutation detected in F1 DNA	During 2018
sa30675	Nonsense	Mutation detected in F1 DNA	During 2018

Mutation Details

Allele Name:: sa42378
Current Status:: Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2018.
Mutation:: T > G
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000125081	Nonsense	86	1368	3	30

Genomic Location (Zv9):

Chromosome 14 (position 19820163)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	14	15614616
GRCz11	14	15920179

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

None

Flanking Sequence:

GAGTTTACTGATCGCCAGGGTCAGCAGTCACCCACTGACACCCCAGGGTA[T/G]AGAGAAATCAGGCTGAAGGAGTGTCAAGGGGTGGCTGGAAAACCCTACTG

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa35677
Current Status:: Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: Order Allele From ZIRC
Mutation:: T > C
Consequence:: Essential Splice Site

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000125081	Essential Splice Site	186	1368	4	30

Genomic Location (Zv9):

Chromosome 14 (position 19804357)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	14	15598810
GRCz11	14	15904373

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

None

Flanking Sequence:

AGTACCATGTCTGGTTTCAGATCCTGACCTAAAAGTCACTCTCTTCTCGG[T/C]AGGTCTCCAACACGCTTCCAGCAGCAACTCACCTGATCTCTCTGTTTCTG

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa9798
Current Status:: Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: Order Allele From ZIRC
Order Allele From EZRC
Mutation:: T > A
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000125081	Nonsense	563	1368	12	30

Genomic Location (Zv9):

Chromosome 14 (position 19773956)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	14	15568409
GRCz11	14	15873972

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

YGGCCGTGTGGTTATWCAGAATGCCAGTGTGCCAGCTATGTACAAGTGCT[T/A]GGCTGAGAACAAAGTGGGAAAAGATGAACGACTGATTTATTTCTACGTAA

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa281
Current Status:: F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2018.
Mutation:: C > A
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000125081	Nonsense	593	1368	13	30

Genomic Location (Zv9):

Chromosome 14 (position 19772144)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	14	15566597
GRCz11	14	15872160

KASP Assay ID:

554-2919.1 (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

TAACATTCATTTAGCTATCCCTGAAGGATTCGATATAGAGATGGAGCCCT[C/A]AGAGGATCCGCTTGAGCAGGACCTGGTRCAGCTGAAGTGTAATGCAGATA

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa35676
Current Status:: Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2018.
Mutation:: C > T
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000125081	Nonsense	741	1368	14	30

Genomic Location (Zv9):

Chromosome 14 (position 19770417)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	14	15564870
GRCz11	14	15870433

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

None

Flanking Sequence:

GCACACCCTTTCCTCAGCTGTCCTGGTTTAAAGATAACCAACCCCTCCAT[C/T]AGATATCAGGTTAGTCATTCATCACACTTTTCAATACTAACATTTAAAAG

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa31980
Current Status:: Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: Order Allele From ZIRC
Mutation:: C > T
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000125081	Nonsense	1031	1368	22	30

Genomic Location (Zv9):

Chromosome 14 (position 19736387)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	14	15530840
GRCz11	14	15836403

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

None

Flanking Sequence:

AAACTCCACTCACAATAGAGGATCTGATATGCTACAGTTTTCAAGTTGCA[C/T]GAGGAATGGAGTTTCTGGCATCTCGTAAGGTAATTTTCAAACATTTATTT

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa44806
Current Status:: Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2018.
Mutation:: T > A
Consequence:: Essential Splice Site

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000125081	Essential Splice Site	1040	1368	22	30

Genomic Location (Zv9):

Chromosome 14 (position 19736356)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	14	15530809
GRCz11	14	15836372

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

None

Flanking Sequence:

CTACAGTTTTCAAGTTGCACGAGGAATGGAGTTTCTGGCATCTCGTAAGG[T/A]AATTTTCAAACATTTATTTAATCTTAACCTCTGTGATGAATCCTTTATTC

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa16036
Current Status:: Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: Order Allele From ZIRC
Order Allele From EZRC
Mutation:: G > A
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000125081	Nonsense	1088	1368	24	30

Genomic Location (Zv9):

Chromosome 14 (position 19733259)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	14	15527712
GRCz11	14	15833275

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

TTATAGGTGAAGTGTTATCTGTCTTTGCAGGCYAGGCTGCCGCTGAAGTG[G/A]ATGGCTCCAGAGAGCATCTTTGATAARGTTTACACCAGTCAGAGTGACGT

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa35675
Current Status:: Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2018.
Mutation:: T > C
Consequence:: Essential Splice Site

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000125081	Essential Splice Site	1119	1368	24	30

Genomic Location (Zv9):

Chromosome 14 (position 19733166)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	14	15527619
GRCz11	14	15833182

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

None

Flanking Sequence:

AGTGACGTCTGGTCTTTTGGAGTTCTGCTCTGGGAGATTTTCTCACTAGG[T/C]AACAGTTAACCGGGGCAGCTGCAATTAACGCAATGGAGCTGATCAATGGA

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa30675
Current Status:: Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2018.
Mutation:: C > T
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000125081	Nonsense	1182	1368	26	30

Genomic Location (Zv9):

Chromosome 14 (position 19729462)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	14	15523915
GRCz11	14	15829478

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

None

Flanking Sequence:

GGGAGAGACCCACATTTCCAGCTCTGGTGGAGATACTTGGAGATCTACTG[C/T]AGGAAAACAGTCTACCAGTGAGAAGATGCACACACACACACACATTGTGA

Associated Phenotype:

Not determined

OMIM

More OMIM information for FLT4

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: