Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
rgs6
- Ensembl ID:
- ENSDARG00000015627
- ZFIN ID:
- ZDB-GENE-030131-31
- Description:
- regulator of G-protein signaling 6 [Source:RefSeq peptide;Acc:NP_001030340]
- Human Orthologue:
- RGS6
- Human Description:
- regulator of G-protein signaling 6 [Source:HGNC Symbol;Acc:10002]
- Mouse Orthologue:
- Rgs6
- Mouse Description:
- regulator of G-protein signaling 6 Gene [Source:MGI Symbol;Acc:MGI:1354730]
Alleles
There are 5 alleles of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa37054 | Nonsense | Mutation detected in F1 DNA | During 2018 |
| sa43460 | Nonsense | Mutation detected in F1 DNA | During 2018 |
| sa37053 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
| sa19237 | Nonsense | Mutation detected in F1 DNA | During 2018 |
| sa15520 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa37054
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000026156 | Nonsense | 263 | 464 | 12 | 17 |
| ENSDART00000075489 | Nonsense | 288 | 489 | 12 | 17 |
| ENSDART00000135513 | Nonsense | 268 | 469 | 11 | 16 |
- Genomic Location (Zv9):
- Chromosome 20 (position 28546441)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 28617654 GRCz11 20 28520533 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACTGTGAATTAAACAACATTAAAATCTTTGTTTTGCAGATTGATGAGCTA[C/A]ACAGAGCAGTATCTTGACTATGACCCTTTTGTGGCAGTACCAGAACCATC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa43460
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000026156 | Nonsense | 352 | 464 | 14 | 17 |
| ENSDART00000075489 | Nonsense | 377 | 489 | 14 | 17 |
| ENSDART00000135513 | Nonsense | 357 | 469 | 13 | 16 |
- Genomic Location (Zv9):
- Chromosome 20 (position 28540847)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 28612060 GRCz11 20 28514939 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTGTCTTTAGATTCTGGTTGGCGGTACAGGATCTGAAGTGTCGCCCCCTG[C/T]AGGAAGTGGCGTCTCGTGCTCAGGAGATCTGGCAGGAGTTTCTTGCCGAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa37053
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > G
- Consequence:
- Essential Splice Site
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000026156 | Essential Splice Site | 401 | 464 | 15 | 17 |
| ENSDART00000075489 | Essential Splice Site | 426 | 489 | 15 | 17 |
| ENSDART00000135513 | Essential Splice Site | 406 | 469 | 14 | 16 |
- Genomic Location (Zv9):
- Chromosome 20 (position 28539878)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 28611091 GRCz11 20 28513970 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTTCGCCCTGGCTGTGGTTTGACTGTCAGCCTCCAATGTTTTTCTCTTTC[A/G]GGACCACATCTACAAGCTGATGAAGAGTGACAGCTACCCTCGATTCCTGC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa19237
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000026156 | Nonsense | 414 | 464 | 15 | 17 |
| ENSDART00000075489 | Nonsense | 439 | 489 | 15 | 17 |
| ENSDART00000135513 | Nonsense | 419 | 469 | 14 | 16 |
- Genomic Location (Zv9):
- Chromosome 20 (position 28539837)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 28611050 GRCz11 20 28513929 - KASP Assay ID:
- 2261-4448.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTCTCTTTCAGGACCACATCTACAAGCTGATGAAGAGTGACAGCTACCCT[C/T]GATTCCTGCGCTCCAATGCTTACCAGGACCTCCTGCTGGCCAGAAAGAAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa15520
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > A
- Consequence:
- Essential Splice Site
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000026156 | Essential Splice Site | 430 | 464 | 15 | 17 |
| ENSDART00000075489 | Essential Splice Site | 455 | 489 | 15 | 17 |
| ENSDART00000135513 | Essential Splice Site | 435 | 469 | 14 | 16 |
- Genomic Location (Zv9):
- Chromosome 20 (position 28539786)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 28610999 GRCz11 20 28513878 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GATTCCTGCGCTCCAATGCTTACCAGGACCTCCTGCTGGCCAGAAAGAAG[G/A]TTAGCCGCTCTTTYAAATCTCTTTCTGCTGTGGAGAATAMRTCTGACTTA
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- C-reactive protein: Meta-analysis of genome-wide association studies in >80 000 subjects identifies multiple loci for C-reactive protein levels. (View Study)
- Economic and political preferences (time): The genetic architecture of economic and political preferences. (View Study)
- Obesity (extreme): Genome-wide population-based association study of extremely overweight young adults--the GOYA study. (View Study)
- Smoking cessation: Genome-wide association for smoking cessation success in a trial of precessation nicotine replacement. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
