znf207b

Ensembl ID:
ENSDARG00000015572
ZFIN ID:
ZDB-GENE-030131-7377
Description:
zinc finger protein 207 [Source:RefSeq peptide;Acc:NP_955959]
Human Orthologue:
ZNF207
Human Description:
zinc finger protein 207 [Source:HGNC Symbol;Acc:12998]
Mouse Orthologue:
Zfp207
Mouse Description:
zinc finger protein 207 Gene [Source:MGI Symbol;Acc:MGI:1340045]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12303 Nonsense Available for shipment Available now
sa40666 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa12303
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027464 Nonsense 171 435 5 12
ENSDART00000073740 Nonsense 171 436 5 10
Genomic Location (Zv9):
Chromosome 6 (position 19298258)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 22140813
GRCz11 6 18612134
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGTGTACCTTAACGCATCGTGTGTGTTTTTAAAGGCATGCCACCCATGT[T/A]GACTGGTGTMCCACCAATGATTCCAGGAATGCCCCCAGTAATGCCAGTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40666
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027464 Nonsense 329 435 10 12
ENSDART00000073740 Nonsense 330 436 8 10
Genomic Location (Zv9):
Chromosome 6 (position 19302938)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 22136133
GRCz11 6 18607454
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCCACCCTCACCACCTTGAGTGCTACCAGTAAGTTGATGCACCCTGAT[G/T]AGGATATCTCGCTGGTGAGTGCTTGAGTTTTGCTCTGACAACTTTTTTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link