zgc:100829

Ensembl ID:
ENSDARG00000015557
ZFIN ID:
ZDB-GENE-040801-54
Description:
hypothetical protein LOC445149 [Source:RefSeq peptide;Acc:NP_001003543]
Human Orthologue:
SH2D2A
Human Description:
SH2 domain containing 2A [Source:HGNC Symbol;Acc:10821]
Mouse Orthologue:
Sh2d2a
Mouse Description:
SH2 domain protein 2A Gene [Source:MGI Symbol;Acc:MGI:1351596]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23961 Nonsense Available for shipment Available now
sa23962 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23961
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014058 Nonsense 261 307 8 8
ENSDART00000137874   None 210 None 5
ENSDART00000145178   None 173 None 3

The following transcripts of ENSDARG00000015557 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 28187338)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 28756249
GRCz11 21 28792944
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTCTCAATGGATTTGGGGTCCGAGGTTGTTGAAGAGAGCTGTTTGGGA[C/T]GAGGAAGGGTTGCTCAGCTCATGAAAACCTTCAGCGTGTGCGGCGAGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23962
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014058 Nonsense 288 307 8 8
ENSDART00000137874   None 210 None 5
ENSDART00000145178   None 173 None 3

The following transcripts of ENSDARG00000015557 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 28187419)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 28756330
GRCz11 21 28793025
KASP Assay ID:
2261-5756.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGCGTGTGCGGCGAGTCTCCACCCTGTCAGTCTCCGCCCCGTGCCAAT[A/T]AACCTCCAATCCCGGAAAAACCGAACCACTTGAGGCTCCGCCCCTCACCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link