zgc:123224

Ensembl ID:
ENSDARG00000015552
ZFIN ID:
ZDB-GENE-051030-69
Description:
Novel protein similar to vertebrate phosphatase and actin regulator family [Source:UniProtKB/TrEMBL;
Human Orthologue:
PHACTR4
Human Description:
phosphatase and actin regulator 4 [Source:HGNC Symbol;Acc:25793]
Mouse Orthologue:
Phactr4
Mouse Description:
phosphatase and actin regulator 4 Gene [Source:MGI Symbol;Acc:MGI:2140327]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8959 Essential Splice Site Mutation detected in F1 DNA During 2018
sa8971 Essential Splice Site Mutation detected in F1 DNA During 2018
sa36800 Nonsense Mutation detected in F1 DNA During 2018
sa23485 Nonsense Available for shipment Available now
sa11544 Essential Splice Site Available for shipment Available now
sa14744 Essential Splice Site Available for shipment Available now
sa3006 Nonsense F2 line generated During 2018

Mutation Details

Allele Name:
sa8959
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048151 Essential Splice Site 74 265 None 3
ENSDART00000055619 Essential Splice Site 57 1014 None 11
ENSDART00000065861 Essential Splice Site 42 693 None 18
ENSDART00000048151 Essential Splice Site 74 265 None 3
ENSDART00000055619 Essential Splice Site 57 1014 None 11
ENSDART00000065861 Essential Splice Site 42 693 None 18
Genomic Location (Zv9):
Chromosome 19 (position 14609140)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 15272744
GRCz11 19 15177106
KASP Assay ID:
1641-0623.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGTGGAGGAAGAAGAAAACCAGTGACAAATTTAAGGAAACATCAGAAGG[T/G]GCTTGCTTKTTAAGGTTTTTTTTTTTTTTTTTTTTGGACTAATAATCCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8971
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048151 Essential Splice Site 74 265 None 3
ENSDART00000055619 Essential Splice Site 57 1014 None 11
ENSDART00000065861 Essential Splice Site 42 693 None 18
ENSDART00000048151 Essential Splice Site 74 265 None 3
ENSDART00000055619 Essential Splice Site 57 1014 None 11
ENSDART00000065861 Essential Splice Site 42 693 None 18
Genomic Location (Zv9):
Chromosome 19 (position 14609140)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 15272744
GRCz11 19 15177106
KASP Assay ID:
1641-0623.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGTGGAGGAAGAAGAAAACCAGTGACAAATTTAAGGAAACATCAGAAGG[T/G]GCTTGCTTKTTAAGGTTTTTTTTTTTTTTTTTTTTGGACTAATAATCCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36800
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048151 Nonsense 164 265 3 3
ENSDART00000055619 Nonsense 174 1014 3 11
ENSDART00000065861   None 693 None 18
Genomic Location (Zv9):
Chromosome 19 (position 14606899)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 15270503
GRCz11 19 15174865
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGCGGATTCCAACTGAACCAGACCGACGTAGCCGCCTGGAGTCAGATTA[T/G]GAGAAACGAACAGGATCATTACCATTAGATAGACCAGGACAGGAGGATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23485
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048151   None 265 None 3
ENSDART00000055619 Nonsense 462 1014 4 11
ENSDART00000065861 Nonsense 207 693 7 18
Genomic Location (Zv9):
Chromosome 19 (position 14601165)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 15264769
GRCz11 19 15169131
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCATCCTCTGCTCCACCCATTGCTAAGCCTCCACCTAGGACTGTGTCTT[T/A]GAATGTAGACGACTCCTCGCGCACTATTCTCATTCCTTCCTTAATAGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11544
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048151   None 265 None 3
ENSDART00000055619 Essential Splice Site 899 1014 8 11
ENSDART00000065861 Essential Splice Site 597 693 14 18
Genomic Location (Zv9):
Chromosome 19 (position 14582041)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 15245645
GRCz11 19 15150007
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTCAGAGGCCCACCGCTCAAGAACTGGAGCAGAGAAACATYCTACTAGG[T/G]CAGTGTTGCAATTCCTTTTCACTAGTTCTCCACTYAACTTATKTGTAGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14744
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048151   None 265 None 3
ENSDART00000055619 Essential Splice Site 920 1014 10 11
ENSDART00000065861 Essential Splice Site 618 693 16 18
Genomic Location (Zv9):
Chromosome 19 (position 14579703)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 15243307
GRCz11 19 15147669
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGGTTGTAATCCTGCAAAACGTGAAAGTTGTTGTGTTTTTWTGTACGCA[G/A]TWGTCTCAGAGGCCCACAATAGCTGACCTGCAGGCCAGAAAAATTCTGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3006
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048151   None 265 None 3
ENSDART00000055619 Nonsense 920 1014 10 11
ENSDART00000065861 Nonsense 618 693 16 18
Genomic Location (Zv9):
Chromosome 19 (position 14579701)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 15243305
GRCz11 19 15147667
KASP Assay ID:
554-2582.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTTGTAATCCTGCAAAACGTGAAAGTTGTTGTGTTTTTTTGTACGCAGT[T/A]GTCTCAGAGGCCCACAATAGCTGACCTGCAGGCCAGAAAAATTCTGCGCT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link