alp

Ensembl ID:
ENSDARG00000015546
ZFIN ID:
ZDB-GENE-040420-1
Description:
alkaline phosphatase [Source:RefSeq peptide;Acc:NP_957301]
Human Orthologue:
ALPL
Human Description:
alkaline phosphatase, liver/bone/kidney [Source:HGNC Symbol;Acc:438]
Mouse Orthologue:
Alpl
Mouse Description:
alkaline phosphatase, liver/bone/kidney Gene [Source:MGI Symbol;Acc:MGI:87983]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa41854 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa41854
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013050   None 292 None 9
ENSDART00000103456 Nonsense 447 450 11 11
ENSDART00000122814   None 293 None 9
ENSDART00000131101   None 529 None 11
ENSDART00000135135   None 129 None 4
ENSDART00000146461   None 561 12 12
ENSDART00000147984   None 229 None 7
Genomic Location (Zv9):
Chromosome 11 (position 28886942)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 27762928
GRCz11 11 28010102
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCAAATGGCTGCTTTGCTGACCCTTCTTCTCTTAAGATGTCTTCAGATC[A/T]AGAACTTTCCTTAATCTTTCTTTTAAGCAGAGATGATGTTGTTTTTGATA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link