znf207a

Ensembl ID:
ENSDARG00000015538
ZFIN ID:
ZDB-GENE-040426-2273
Description:
zinc finger protein 207 [Source:RefSeq peptide;Acc:NP_998362]
Human Orthologue:
ZNF207
Human Description:
zinc finger protein 207 [Source:HGNC Symbol;Acc:12998]
Mouse Orthologue:
Zfp207
Mouse Description:
zinc finger protein 207 Gene [Source:MGI Symbol;Acc:MGI:1340045]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa8606 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa8606
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044859 Nonsense 397 437 10 10
ENSDART00000124631 Nonsense 397 437 10 12
Genomic Location (Zv9):
Chromosome 3 (position 34329645)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 34114841
GRCz11 3 34244349
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTTCTCATGCAGGTCCATACGGTGCTCCRCCGCAGGCAGTGCCTGGGTA[T/G]GTCCCGGGTGGGATGCCACCATATGGCCAAGCTCCACCAATGGTTCCTCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link