sox6

Ensembl ID:
ENSDARG00000015536
ZFIN ID:
ZDB-GENE-081120-6
Description:
transcription factor SOX-6 [Source:RefSeq peptide;Acc:NP_001116481]
Human Orthologue:
SOX6
Human Description:
SRY (sex determining region Y)-box 6 [Source:HGNC Symbol;Acc:16421]
Mouse Orthologue:
Sox6
Mouse Description:
SRY-box containing gene 6 Gene [Source:MGI Symbol;Acc:MGI:98368]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9376 Essential Splice Site Mutation detected in F1 DNA During 2018
sa38612 Essential Splice Site Mutation detected in F1 DNA During 2018
sa20951 Nonsense Available for shipment Available now
sa44663 Nonsense Mutation detected in F1 DNA During 2018
sa45277 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa9376
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100998 Essential Splice Site None 768 1 15
Genomic Location (Zv9):
Chromosome 7 (position 28416443)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 27019382
GRCz11 7 27290575
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCCAAATGCTGAACATGGAGGGCTTTCTGCGTAGCAGCTTTTTACTGAG[G/A]TTAGTCGCTTTAGTTTTTCTGTCRTTGCCACAGGGGGTCCGGCGGGCTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38612
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100998 Essential Splice Site 80 768 2 15
Genomic Location (Zv9):
Chromosome 7 (position 28446580)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 27049519
GRCz11 7 27320712
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCACCCGAATCCGACTGGGACAGCCTGATGTCAGCTCAGCAGCGCATGG[T/C]GAGTGCCACTGCCAGCGTTTCTTAGCTCATTTAAGTGTGCTACCACACGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20951
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100998 Nonsense 252 768 6 15
Genomic Location (Zv9):
Chromosome 7 (position 28498299)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 27101238
GRCz11 7 27372431
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCCTTTGTAGATCGCCAGACAACAGCAGCAACTTCTGCAGCAACAGCAC[A/T]AAATCAATCTCCTCCAGCAGCAGATTCAGGTCAGTGCTCGACTTTCACGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44663
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100998 Nonsense 351 768 9 15
Genomic Location (Zv9):
Chromosome 7 (position 28545720)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 27148659
GRCz11 7 27419852
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTGGCCAGCATGCAGGTCTCTCCAGGAGCCAAGATGCCTCCGCTGCCC[C/T]AGCCCCCCAATTCTGCTGGGCAGATCTCCCCGTCTGGCTTGAAGAACGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45277
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100998 Nonsense 383 768 10 15
Genomic Location (Zv9):
Chromosome 7 (position 28548044)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 27150983
GRCz11 7 27422176
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCTGTTTTAACAGAAGCTTTGTGTCTTTTATGTGCAGGAGGAGGGAACG[C/T]AGCCTCTCAACCTCTCCGCCCGGCCTAAAACAGCTGAGCCCATCAAATCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link