
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
adam10b
- Ensembl ID:
- ENSDARG00000015502
- ZFIN ID:
- ZDB-GENE-071115-1
- Description:
- a disintegrin and metalloprotease domain 10b [Source:RefSeq peptide;Acc:NP_956714]
- Human Orthologue:
- ADAM10
- Human Description:
- ADAM metallopeptidase domain 10 [Source:HGNC Symbol;Acc:188]
- Mouse Orthologue:
- Adam10
- Mouse Description:
- a disintegrin and metallopeptidase domain 10 Gene [Source:MGI Symbol;Acc:MGI:109548]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa24577 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa24577
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000008663 | Essential Splice Site | 26 | 606 | 1 | 15 |
- Genomic Location (Zv9):
- Chromosome 25 (position 18357)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 25 65517 GRCz11 25 150649 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GGTGCTCCCGGTGCTGCTGGGCCTCCTCTGCGCCTCCGGGCCCGCTCGAG[G/A]TGAGTGTGAGCCGGTGTGGAGCCGAGCTAACGGTAACGCTAGCTCTCGGC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: