zgc:113518

Ensembl ID:
ENSDARG00000015482
ZFIN IDs:
ZDB-GENE-050220-9, ZDB-GENE-080220-9
Description:
hypothetical protein LOC100141333 [Source:RefSeq peptide;Acc:NP_001108370]
Human Orthologues:
BX248098.1, ZNF107, ZNF160, ZNF197, ZNF208, ZNF616, ZNF658, ZNF721, ZNF729, ZNF808, ZNF836, ZNF841, ZNF845, ZNF91, ZNF99
Human Descriptions:
zinc finger protein 107 [Source:HGNC Symbol;Acc:12887]
zinc finger protein 160 [Source:HGNC Symbol;Acc:12948]
zinc finger protein 197 [Source:HGNC Symbol;Acc:12988]
zinc finger protein 208 [Source:HGNC Symbol;Acc:12999]
zinc finger protein 616 [Source:HGNC Symbol;Acc:28062]
zinc finger protein 658 [Source:HGNC Symbol;Acc:25226]
Zinc finger protein 658B [Source:UniProtKB/Swiss-Prot;Acc:Q4V348]
zinc finger protein 721 [Source:HGNC Symbol;Acc:29425]
zinc finger protein 729 [Source:HGNC Symbol;Acc:32464]
zinc finger protein 808 [Source:HGNC Symbol;Acc:33230]
zinc finger protein 836 [Source:HGNC Symbol;Acc:34333]
zinc finger protein 841 [Source:HGNC Symbol;Acc:27611]
zinc finger protein 845 [Source:HGNC Symbol;Acc:25112]
zinc finger protein 91 [Source:HGNC Symbol;Acc:13166]
zinc finger protein 99 [Source:HGNC Symbol;Acc:13175]
Mouse Orthologues:
A530054K11Rik, AA987161, Zfp748
Mouse Descriptions:
expressed sequence AA987161 Gene [Source:MGI Symbol;Acc:MGI:2145180]
RIKEN cDNA A530054K11 gene Gene [Source:MGI Symbol;Acc:MGI:3036250]
zinc finger protein 748 Gene [Source:MGI Symbol;Acc:MGI:1916455]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19645 Nonsense Available for shipment Available now
sa15930 Nonsense Available for shipment Available now
sa19644 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa19645
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034783   None 315 None 3
ENSDART00000101067 Nonsense 428 508 4 4
ENSDART00000126704 Nonsense 682 985 5 6
Genomic Location (Zv9):
Chromosome 2 (position 232654)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 199322
GRCz11 2 188233
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGGAAGCCTTCAGGGACACGAGAGGATCCACACCGGAGAGAAGCCCTA[C/A]ACCTGTGACGAGTGCGGGAAGAGTTTCAAATGGCGGAGGAGTCTCCAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15930
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034783   None 315 None 3
ENSDART00000101067 Nonsense 504 508 4 4
ENSDART00000126704   None 985 None 6
Genomic Location (Zv9):
Chromosome 2 (position 232428)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 199096
GRCz11 2 188007
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGGTGTGYGGGAAGGGCTTTGTAAGGTTGTGCTTTTTAAAAATGCATCTA[G/T]AAAAGAATSCACACTGAYAATGACCTAGCGACAAGTCTCTATTAATAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19644
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034783 Essential Splice Site 19 315 3 3
ENSDART00000101067   None 508 None 4
ENSDART00000126704   None 985 None 6
Genomic Location (Zv9):
Chromosome 2 (position 222764)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 189432
GRCz11 2 178343
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCATAGAGGTGTCGTTTGATACTAAACTCTGAATCTGCTTTGTATTTTA[G/A]ACTTCATTGTAGTCAAAGTGGAAAATGAAGACGAGAGAGTAATAATAGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link